ID: 995585160

View in Genome Browser
Species Human (GRCh38)
Location 5:113641282-113641304
Sequence GGCCTTTGCAGTCCAGGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995585155_995585160 6 Left 995585155 5:113641253-113641275 CCTTGGGGTGTCAGAACTCCAGG No data
Right 995585160 5:113641282-113641304 GGCCTTTGCAGTCCAGGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995585160 Original CRISPR GGCCTTTGCAGTCCAGGACT TGG Intergenic
No off target data available for this crispr