ID: 995588639

View in Genome Browser
Species Human (GRCh38)
Location 5:113675025-113675047
Sequence GTGGACACAAAGGTTGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995588633_995588639 17 Left 995588633 5:113674985-113675007 CCTGGAATGATTTGTCTCACAAC No data
Right 995588639 5:113675025-113675047 GTGGACACAAAGGTTGAGGTTGG No data
995588636_995588639 -5 Left 995588636 5:113675007-113675029 CCAAGAGAATTAAGGAGTGTGGA 0: 9
1: 24
2: 45
3: 76
4: 236
Right 995588639 5:113675025-113675047 GTGGACACAAAGGTTGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995588639 Original CRISPR GTGGACACAAAGGTTGAGGT TGG Intergenic
No off target data available for this crispr