ID: 995591386

View in Genome Browser
Species Human (GRCh38)
Location 5:113703947-113703969
Sequence CAAAATGAAGATATTGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995591386_995591392 18 Left 995591386 5:113703947-113703969 CCCATTTCAATATCTTCATTTTG No data
Right 995591392 5:113703988-113704010 CAATAAGTATCAATCTGGGAAGG No data
995591386_995591388 13 Left 995591386 5:113703947-113703969 CCCATTTCAATATCTTCATTTTG No data
Right 995591388 5:113703983-113704005 AAACCCAATAAGTATCAATCTGG No data
995591386_995591389 14 Left 995591386 5:113703947-113703969 CCCATTTCAATATCTTCATTTTG No data
Right 995591389 5:113703984-113704006 AACCCAATAAGTATCAATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995591386 Original CRISPR CAAAATGAAGATATTGAAAT GGG (reversed) Intergenic
No off target data available for this crispr