ID: 995596589

View in Genome Browser
Species Human (GRCh38)
Location 5:113754003-113754025
Sequence AAAAACACAAATTGCAGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995596589_995596593 -1 Left 995596589 5:113754003-113754025 CCCGACCTGCAATTTGTGTTTTT No data
Right 995596593 5:113754025-113754047 TCCCACTACTTTGTATGTCAGGG No data
995596589_995596596 23 Left 995596589 5:113754003-113754025 CCCGACCTGCAATTTGTGTTTTT No data
Right 995596596 5:113754049-113754071 CATCTTTCTTTGTTAGCTTATGG No data
995596589_995596592 -2 Left 995596589 5:113754003-113754025 CCCGACCTGCAATTTGTGTTTTT No data
Right 995596592 5:113754024-113754046 TTCCCACTACTTTGTATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995596589 Original CRISPR AAAAACACAAATTGCAGGTC GGG (reversed) Intergenic
No off target data available for this crispr