ID: 995596590

View in Genome Browser
Species Human (GRCh38)
Location 5:113754004-113754026
Sequence GAAAAACACAAATTGCAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995596590_995596592 -3 Left 995596590 5:113754004-113754026 CCGACCTGCAATTTGTGTTTTTC No data
Right 995596592 5:113754024-113754046 TTCCCACTACTTTGTATGTCAGG No data
995596590_995596596 22 Left 995596590 5:113754004-113754026 CCGACCTGCAATTTGTGTTTTTC No data
Right 995596596 5:113754049-113754071 CATCTTTCTTTGTTAGCTTATGG No data
995596590_995596593 -2 Left 995596590 5:113754004-113754026 CCGACCTGCAATTTGTGTTTTTC No data
Right 995596593 5:113754025-113754047 TCCCACTACTTTGTATGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995596590 Original CRISPR GAAAAACACAAATTGCAGGT CGG (reversed) Intergenic
No off target data available for this crispr