ID: 995596591

View in Genome Browser
Species Human (GRCh38)
Location 5:113754008-113754030
Sequence GTGGGAAAAACACAAATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995596591_995596593 -6 Left 995596591 5:113754008-113754030 CCTGCAATTTGTGTTTTTCCCAC No data
Right 995596593 5:113754025-113754047 TCCCACTACTTTGTATGTCAGGG No data
995596591_995596596 18 Left 995596591 5:113754008-113754030 CCTGCAATTTGTGTTTTTCCCAC No data
Right 995596596 5:113754049-113754071 CATCTTTCTTTGTTAGCTTATGG No data
995596591_995596592 -7 Left 995596591 5:113754008-113754030 CCTGCAATTTGTGTTTTTCCCAC No data
Right 995596592 5:113754024-113754046 TTCCCACTACTTTGTATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995596591 Original CRISPR GTGGGAAAAACACAAATTGC AGG (reversed) Intergenic
No off target data available for this crispr