ID: 995596593

View in Genome Browser
Species Human (GRCh38)
Location 5:113754025-113754047
Sequence TCCCACTACTTTGTATGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995596589_995596593 -1 Left 995596589 5:113754003-113754025 CCCGACCTGCAATTTGTGTTTTT No data
Right 995596593 5:113754025-113754047 TCCCACTACTTTGTATGTCAGGG No data
995596591_995596593 -6 Left 995596591 5:113754008-113754030 CCTGCAATTTGTGTTTTTCCCAC No data
Right 995596593 5:113754025-113754047 TCCCACTACTTTGTATGTCAGGG No data
995596590_995596593 -2 Left 995596590 5:113754004-113754026 CCGACCTGCAATTTGTGTTTTTC No data
Right 995596593 5:113754025-113754047 TCCCACTACTTTGTATGTCAGGG No data
995596588_995596593 7 Left 995596588 5:113753995-113754017 CCACTGTGCCCGACCTGCAATTT No data
Right 995596593 5:113754025-113754047 TCCCACTACTTTGTATGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995596593 Original CRISPR TCCCACTACTTTGTATGTCA GGG Intergenic
No off target data available for this crispr