ID: 995597582

View in Genome Browser
Species Human (GRCh38)
Location 5:113764363-113764385
Sequence TTTACTTCTCAGAACTAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995597582_995597584 1 Left 995597582 5:113764363-113764385 CCTACCTAGTTCTGAGAAGTAAA No data
Right 995597584 5:113764387-113764409 GACCAACTTCATAAGCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995597582 Original CRISPR TTTACTTCTCAGAACTAGGT AGG (reversed) Intergenic
No off target data available for this crispr