ID: 995600797

View in Genome Browser
Species Human (GRCh38)
Location 5:113793373-113793395
Sequence TGCCACATTGCACACCCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995600797_995600799 20 Left 995600797 5:113793373-113793395 CCTTAGGGGTGTGCAATGTGGCA No data
Right 995600799 5:113793416-113793438 TTGAAACATTATTTTGTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995600797 Original CRISPR TGCCACATTGCACACCCCTA AGG (reversed) Intergenic
No off target data available for this crispr