ID: 995601400

View in Genome Browser
Species Human (GRCh38)
Location 5:113800959-113800981
Sequence AATTTAGCAAAGACAGAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995601399_995601400 -3 Left 995601399 5:113800939-113800961 CCTCGTTTTAGAGATGAAGGAAT No data
Right 995601400 5:113800959-113800981 AATTTAGCAAAGACAGAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995601400 Original CRISPR AATTTAGCAAAGACAGAACT AGG Intergenic
No off target data available for this crispr