ID: 995601948

View in Genome Browser
Species Human (GRCh38)
Location 5:113807061-113807083
Sequence CAGAGCTGTCACTTTGGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995601936_995601948 28 Left 995601936 5:113807010-113807032 CCTCCTTTCTGAGGCTTGAGGGA No data
Right 995601948 5:113807061-113807083 CAGAGCTGTCACTTTGGCTCTGG No data
995601942_995601948 -4 Left 995601942 5:113807042-113807064 CCTTCCTGCCTGGGGCGCCCAGA No data
Right 995601948 5:113807061-113807083 CAGAGCTGTCACTTTGGCTCTGG No data
995601943_995601948 -8 Left 995601943 5:113807046-113807068 CCTGCCTGGGGCGCCCAGAGCTG No data
Right 995601948 5:113807061-113807083 CAGAGCTGTCACTTTGGCTCTGG No data
995601937_995601948 25 Left 995601937 5:113807013-113807035 CCTTTCTGAGGCTTGAGGGAGAG No data
Right 995601948 5:113807061-113807083 CAGAGCTGTCACTTTGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995601948 Original CRISPR CAGAGCTGTCACTTTGGCTC TGG Intergenic
No off target data available for this crispr