ID: 995603534

View in Genome Browser
Species Human (GRCh38)
Location 5:113825509-113825531
Sequence TCAGAACCACACCTAGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995603534_995603535 17 Left 995603534 5:113825509-113825531 CCAGGCACTAGGTGTGGTTCTGA No data
Right 995603535 5:113825549-113825571 AGATAGAACTCCTGTGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995603534 Original CRISPR TCAGAACCACACCTAGTGCC TGG (reversed) Intergenic
No off target data available for this crispr