ID: 995608006

View in Genome Browser
Species Human (GRCh38)
Location 5:113879205-113879227
Sequence CACAGGACTGGGGAAGCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995608006_995608014 29 Left 995608006 5:113879205-113879227 CCTGAGGCTTCCCCAGTCCTGTG No data
Right 995608014 5:113879257-113879279 ATATTAATTACCCAATAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995608006 Original CRISPR CACAGGACTGGGGAAGCCTC AGG (reversed) Intergenic
No off target data available for this crispr