ID: 995608009

View in Genome Browser
Species Human (GRCh38)
Location 5:113879216-113879238
Sequence GCTCACAGTTCCACAGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995608009_995608014 18 Left 995608009 5:113879216-113879238 CCCAGTCCTGTGGAACTGTGAGC No data
Right 995608014 5:113879257-113879279 ATATTAATTACCCAATAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995608009 Original CRISPR GCTCACAGTTCCACAGGACT GGG (reversed) Intergenic
No off target data available for this crispr