ID: 995608010 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:113879217-113879239 |
Sequence | GGCTCACAGTTCCACAGGAC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
995608010_995608014 | 17 | Left | 995608010 | 5:113879217-113879239 | CCAGTCCTGTGGAACTGTGAGCC | No data | ||
Right | 995608014 | 5:113879257-113879279 | ATATTAATTACCCAATAAATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
995608010 | Original CRISPR | GGCTCACAGTTCCACAGGAC TGG (reversed) | Intergenic | ||