ID: 995608010

View in Genome Browser
Species Human (GRCh38)
Location 5:113879217-113879239
Sequence GGCTCACAGTTCCACAGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995608010_995608014 17 Left 995608010 5:113879217-113879239 CCAGTCCTGTGGAACTGTGAGCC No data
Right 995608014 5:113879257-113879279 ATATTAATTACCCAATAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995608010 Original CRISPR GGCTCACAGTTCCACAGGAC TGG (reversed) Intergenic