ID: 995608011

View in Genome Browser
Species Human (GRCh38)
Location 5:113879222-113879244
Sequence TAATTGGCTCACAGTTCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 12099
Summary {0: 231, 1: 977, 2: 2316, 3: 3783, 4: 4792}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995608011_995608014 12 Left 995608011 5:113879222-113879244 CCTGTGGAACTGTGAGCCAATTA 0: 231
1: 977
2: 2316
3: 3783
4: 4792
Right 995608014 5:113879257-113879279 ATATTAATTACCCAATAAATTGG No data
995608011_995608018 28 Left 995608011 5:113879222-113879244 CCTGTGGAACTGTGAGCCAATTA 0: 231
1: 977
2: 2316
3: 3783
4: 4792
Right 995608018 5:113879273-113879295 AAATTGGTACCACAAAGAGTGGG No data
995608011_995608019 29 Left 995608011 5:113879222-113879244 CCTGTGGAACTGTGAGCCAATTA 0: 231
1: 977
2: 2316
3: 3783
4: 4792
Right 995608019 5:113879274-113879296 AATTGGTACCACAAAGAGTGGGG 0: 7
1: 69
2: 113
3: 150
4: 257
995608011_995608017 27 Left 995608011 5:113879222-113879244 CCTGTGGAACTGTGAGCCAATTA 0: 231
1: 977
2: 2316
3: 3783
4: 4792
Right 995608017 5:113879272-113879294 TAAATTGGTACCACAAAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995608011 Original CRISPR TAATTGGCTCACAGTTCCAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr