ID: 995608013

View in Genome Browser
Species Human (GRCh38)
Location 5:113879254-113879276
Sequence ATTTATTGGGTAATTAATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995608013_995608021 11 Left 995608013 5:113879254-113879276 CCAATATTAATTACCCAATAAAT No data
Right 995608021 5:113879288-113879310 AGAGTGGGGCGCTGCTGTAGAGG No data
995608013_995608022 24 Left 995608013 5:113879254-113879276 CCAATATTAATTACCCAATAAAT No data
Right 995608022 5:113879301-113879323 GCTGTAGAGGCCCAGAAATGTGG No data
995608013_995608017 -5 Left 995608013 5:113879254-113879276 CCAATATTAATTACCCAATAAAT No data
Right 995608017 5:113879272-113879294 TAAATTGGTACCACAAAGAGTGG No data
995608013_995608018 -4 Left 995608013 5:113879254-113879276 CCAATATTAATTACCCAATAAAT No data
Right 995608018 5:113879273-113879295 AAATTGGTACCACAAAGAGTGGG No data
995608013_995608019 -3 Left 995608013 5:113879254-113879276 CCAATATTAATTACCCAATAAAT No data
Right 995608019 5:113879274-113879296 AATTGGTACCACAAAGAGTGGGG 0: 7
1: 69
2: 113
3: 150
4: 257
995608013_995608023 27 Left 995608013 5:113879254-113879276 CCAATATTAATTACCCAATAAAT No data
Right 995608023 5:113879304-113879326 GTAGAGGCCCAGAAATGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995608013 Original CRISPR ATTTATTGGGTAATTAATAT TGG (reversed) Intergenic
No off target data available for this crispr