ID: 995608014

View in Genome Browser
Species Human (GRCh38)
Location 5:113879257-113879279
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995608006_995608014 29 Left 995608006 5:113879205-113879227 CCTGAGGCTTCCCCAGTCCTGTG No data
Right 995608014 5:113879257-113879279 ATATTAATTACCCAATAAATTGG No data
995608008_995608014 19 Left 995608008 5:113879215-113879237 CCCCAGTCCTGTGGAACTGTGAG No data
Right 995608014 5:113879257-113879279 ATATTAATTACCCAATAAATTGG No data
995608010_995608014 17 Left 995608010 5:113879217-113879239 CCAGTCCTGTGGAACTGTGAGCC No data
Right 995608014 5:113879257-113879279 ATATTAATTACCCAATAAATTGG No data
995608011_995608014 12 Left 995608011 5:113879222-113879244 CCTGTGGAACTGTGAGCCAATTA No data
Right 995608014 5:113879257-113879279 ATATTAATTACCCAATAAATTGG No data
995608012_995608014 -4 Left 995608012 5:113879238-113879260 CCAATTAAATCTCTTTCCAATAT No data
Right 995608014 5:113879257-113879279 ATATTAATTACCCAATAAATTGG No data
995608009_995608014 18 Left 995608009 5:113879216-113879238 CCCAGTCCTGTGGAACTGTGAGC No data
Right 995608014 5:113879257-113879279 ATATTAATTACCCAATAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type