ID: 995608016

View in Genome Browser
Species Human (GRCh38)
Location 5:113879268-113879290
Sequence TCTTTGTGGTACCAATTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995608016_995608022 10 Left 995608016 5:113879268-113879290 CCAATAAATTGGTACCACAAAGA No data
Right 995608022 5:113879301-113879323 GCTGTAGAGGCCCAGAAATGTGG No data
995608016_995608026 22 Left 995608016 5:113879268-113879290 CCAATAAATTGGTACCACAAAGA No data
Right 995608026 5:113879313-113879335 CAGAAATGTGGAGGTGACTTTGG No data
995608016_995608021 -3 Left 995608016 5:113879268-113879290 CCAATAAATTGGTACCACAAAGA No data
Right 995608021 5:113879288-113879310 AGAGTGGGGCGCTGCTGTAGAGG No data
995608016_995608027 29 Left 995608016 5:113879268-113879290 CCAATAAATTGGTACCACAAAGA No data
Right 995608027 5:113879320-113879342 GTGGAGGTGACTTTGGAACCAGG No data
995608016_995608023 13 Left 995608016 5:113879268-113879290 CCAATAAATTGGTACCACAAAGA No data
Right 995608023 5:113879304-113879326 GTAGAGGCCCAGAAATGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995608016 Original CRISPR TCTTTGTGGTACCAATTTAT TGG (reversed) Intergenic