ID: 995608017

View in Genome Browser
Species Human (GRCh38)
Location 5:113879272-113879294
Sequence TAAATTGGTACCACAAAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995608012_995608017 11 Left 995608012 5:113879238-113879260 CCAATTAAATCTCTTTCCAATAT No data
Right 995608017 5:113879272-113879294 TAAATTGGTACCACAAAGAGTGG No data
995608013_995608017 -5 Left 995608013 5:113879254-113879276 CCAATATTAATTACCCAATAAAT No data
Right 995608017 5:113879272-113879294 TAAATTGGTACCACAAAGAGTGG No data
995608011_995608017 27 Left 995608011 5:113879222-113879244 CCTGTGGAACTGTGAGCCAATTA 0: 231
1: 977
2: 2316
3: 3783
4: 4792
Right 995608017 5:113879272-113879294 TAAATTGGTACCACAAAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995608017 Original CRISPR TAAATTGGTACCACAAAGAG TGG Intergenic
No off target data available for this crispr