ID: 995608019

View in Genome Browser
Species Human (GRCh38)
Location 5:113879274-113879296
Sequence AATTGGTACCACAAAGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 596
Summary {0: 7, 1: 69, 2: 113, 3: 150, 4: 257}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995608013_995608019 -3 Left 995608013 5:113879254-113879276 CCAATATTAATTACCCAATAAAT No data
Right 995608019 5:113879274-113879296 AATTGGTACCACAAAGAGTGGGG 0: 7
1: 69
2: 113
3: 150
4: 257
995608012_995608019 13 Left 995608012 5:113879238-113879260 CCAATTAAATCTCTTTCCAATAT No data
Right 995608019 5:113879274-113879296 AATTGGTACCACAAAGAGTGGGG 0: 7
1: 69
2: 113
3: 150
4: 257
995608011_995608019 29 Left 995608011 5:113879222-113879244 CCTGTGGAACTGTGAGCCAATTA 0: 231
1: 977
2: 2316
3: 3783
4: 4792
Right 995608019 5:113879274-113879296 AATTGGTACCACAAAGAGTGGGG 0: 7
1: 69
2: 113
3: 150
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995608019 Original CRISPR AATTGGTACCACAAAGAGTG GGG Intergenic
900197824 1:1386032-1386054 AAACGGTACCACCAGGAGTGGGG + Intronic
901252604 1:7792054-7792076 AACTTGTACTGCAAAGAGTGGGG - Intronic
901946978 1:12712084-12712106 AAGAGGTACCACAAGGAGTAGGG - Intergenic
902084392 1:13847849-13847871 AATTGGTACTTCAGACAGTGGGG + Intergenic
905027023 1:34857674-34857696 AATTGGAACCAAAGAGAGAGGGG - Intronic
906833402 1:49058582-49058604 AATTAGTATCATAGAGAGTGGGG + Intronic
906894581 1:49757342-49757364 AATTGGTACTGCAGAGAGTGGGG + Intronic
907188329 1:52629135-52629157 AAGTGTGGCCACAAAGAGTGAGG + Intergenic
907586145 1:55619803-55619825 AATTGGTTCTGCAGAGAGTGTGG + Intergenic
907687089 1:56622817-56622839 AATGTGTACCGCAAAGAGTGGGG + Intronic
908746955 1:67385089-67385111 AATTGGTACCATAGAGAGTGGGG - Intronic
909083601 1:71146071-71146093 AATTGGTACCACAGAGAATGAGG + Intergenic
909129448 1:71715942-71715964 AATTGGTACCACAGAGAGTAGGG - Intronic
909244874 1:73268943-73268965 CATTGAAACCACAGAGAGTGGGG + Intergenic
909757159 1:79240654-79240676 AATTGGTACCACAGAGAGTGTGG - Intergenic
909810130 1:79923394-79923416 AATTGGTACCACAGAGAGTGGGG + Intergenic
910103155 1:83599920-83599942 TATTGGTACCAAAAAAAGTGGGG - Intergenic
910357683 1:86378464-86378486 AATTGGTACTGCAGAGAGTGGGG - Intronic
911695978 1:100890904-100890926 AATTGGTACTGCAGAGAGTAGGG - Intronic
911780258 1:101868157-101868179 AATTGGTACCACTGAGAGTGGGG + Intronic
911848546 1:102784759-102784781 ATCTGATACCACAGAGAGTGAGG - Intergenic
912073048 1:105838511-105838533 AATTGATACCACAGAAAGTGGGG + Intergenic
913383812 1:118238328-118238350 ACTTGGTACCATAGAGAGTTGGG + Intergenic
914988248 1:152477844-152477866 AATTGGTACTACAGAGAGTGAGG - Intergenic
915380393 1:155434375-155434397 AATTGGGAACACAAAGGGTGGGG + Intronic
915983041 1:160434440-160434462 AATTGGTACAACAGAGAGTGGGG - Intergenic
915986561 1:160471476-160471498 AATTTGTAGCACAATGATTGTGG - Intergenic
916987418 1:170206777-170206799 AATTGGTACTGCACAGAGTGGGG + Intergenic
917140242 1:171828025-171828047 AATTGGTACCAGGAGTAGTGGGG - Intergenic
917228984 1:172815197-172815219 AATTGGTACCACAGAGAGTGGGG - Intergenic
917261503 1:173174401-173174423 AACTGGTACCACAGAGAGTGGGG - Intergenic
917459848 1:175220776-175220798 AGAGGGTCCCACAAAGAGTGGGG + Intergenic
918591606 1:186246722-186246744 AATTGGTATCATGGAGAGTGGGG - Intergenic
918917885 1:190668796-190668818 AATTGGTAGCAAAAAGAAGGGGG + Intergenic
919261909 1:195207636-195207658 AATTGGTAACGCAGAGAGTGGGG + Intergenic
919372038 1:196739805-196739827 AATTGGTACTGCAGAGAGTAGGG - Intronic
919473882 1:198011082-198011104 AATTGGTACCACAGAGAGTGGGG - Intergenic
920896076 1:210050531-210050553 AATTGCTACCAGTTAGAGTGGGG - Intronic
923427934 1:233890727-233890749 AGTTGGTATCACAGAGAGTGGGG + Intergenic
924317973 1:242818067-242818089 AAATGGAATCTCAAAGAGTGTGG - Intergenic
924394640 1:243606174-243606196 CATTGGTACCACAGAGAGTGTGG + Intronic
924498837 1:244616688-244616710 AATTGGTCCCACCAGGAGTTTGG - Intronic
1064224091 10:13467231-13467253 ACTTGGTGCCTGAAAGAGTGAGG - Intronic
1068221436 10:54051172-54051194 CATTGGTACCACAGAAAGTAGGG + Intronic
1069077485 10:64053090-64053112 AATTGGTACCCCAGAGAGTGGGG - Intergenic
1069339766 10:67397058-67397080 TATTGGTACCACAGAGAGTGGGG + Intronic
1069397909 10:68010069-68010091 AATTGGGAACACAAAGGGTGGGG - Intronic
1071738215 10:88326135-88326157 AATTGGTACCTCAGAGAGTGGGG + Intronic
1072230924 10:93413405-93413427 TATGGGTTCCACAAAGAATGAGG + Intronic
1072808091 10:98438189-98438211 AATTGGTACCACAGAGAGTGAGG + Intronic
1073627892 10:105118463-105118485 AATTGGTACTACAGAGAGTGGGG + Intronic
1073934909 10:108619425-108619447 AATTTGTACCTCAAATAGTTGGG - Intergenic
1074566316 10:114581563-114581585 AATTTGTACCAGTAAGAGAGAGG + Intronic
1075568350 10:123520723-123520745 ACTTGGGACAACAAAGAGTGGGG - Intergenic
1077709994 11:4526439-4526461 AATAGACACCAAAAAGAGTGGGG + Intergenic
1077876173 11:6308806-6308828 AATTTTTACCATAAAGAGTTAGG - Intergenic
1077979669 11:7287022-7287044 AATTGGTACCGCAGAGAGTGAGG - Intronic
1078251483 11:9620171-9620193 ATCTGGAAACACAAAGAGTGGGG + Intergenic
1079804214 11:24909809-24909831 AATTGGCACCACAGGGAATGGGG + Intronic
1079834881 11:25322303-25322325 AATTGGTACCACAAAGAGTGGGG + Intergenic
1079916090 11:26370450-26370472 AATTGGTACCACAGAGAGTAGGG + Intronic
1081373730 11:42334850-42334872 AATTGGTACAGCAGAGAGTGGGG - Intergenic
1081388853 11:42504657-42504679 AATTGGTACCACAGAGAGTGGGG - Intergenic
1082858023 11:57826957-57826979 AATTGGTAGAACATAGGGTGAGG + Intergenic
1082981781 11:59130870-59130892 AATTGGTATCACAGAGAGTGGGG + Intergenic
1084200098 11:67551040-67551062 AATTGGTACTGCAGAGAGTGGGG + Intergenic
1086309637 11:85521493-85521515 AACTGGTGCCACAGAGAGTGGGG + Intronic
1086849090 11:91787423-91787445 AATTCTTACCACCAAGAGTTTGG - Intergenic
1087571207 11:99929404-99929426 AACTGGCACCACGGAGAGTGGGG - Intronic
1088101996 11:106166100-106166122 AATTTGTACCATAGAGAGTGGGG - Intergenic
1088491125 11:110388907-110388929 AATTGGTACCTGAAATAGGGGGG - Intergenic
1092086158 12:5763530-5763552 AATTAGTACCAGAAAGAGTCTGG + Intronic
1092396665 12:8133636-8133658 AATTGGGAACACAAAGGGTGGGG - Intronic
1094421277 12:30273661-30273683 AATTGGTACCACATAGAGTGGGG - Intergenic
1095249060 12:39957634-39957656 AATTTGTCCCAAAATGAGTGTGG - Intronic
1095378936 12:41565899-41565921 GATTGTTACTACTAAGAGTGGGG - Intronic
1095915411 12:47473053-47473075 TCTTGGTACCAAAAAGATTGGGG + Intergenic
1096121802 12:49093439-49093461 CATTGGAACCACCTAGAGTGAGG - Intronic
1096565988 12:52479680-52479702 AATTGTTACCACAGAAAGTGGGG + Intergenic
1097368004 12:58741580-58741602 AATTGCTACCACAGAGAGTGGGG + Intronic
1097443865 12:59645654-59645676 AATTAGAACCACAGAGAGTGGGG + Intronic
1098145064 12:67489502-67489524 AATTAGTACCACAGAGAGTGGGG - Intergenic
1098836254 12:75427988-75428010 AATTGGTACCAGTTATAGTGAGG + Intronic
1099492680 12:83306433-83306455 AATTGGTACCCCAGAGAGTGGGG + Intergenic
1099605006 12:84793828-84793850 CATTGGAACCATAAAGATTGAGG + Intergenic
1099700502 12:86076472-86076494 AATTGGTACTACCAAGAGTGGGG - Intronic
1099900058 12:88696327-88696349 AATTGGTACCACAGAGAGTGGGG - Intergenic
1100031713 12:90200684-90200706 AATTGATACCTATAAGAGTGAGG + Intergenic
1100933545 12:99638135-99638157 AATTGGTAACACAGAGAGTGGGG + Intronic
1101190330 12:102325961-102325983 AATTGGTACCACAGAGAGTGGGG + Intergenic
1101193149 12:102355379-102355401 AATTGGTACCACAGAGAGTGTGG - Intergenic
1101762347 12:107669262-107669284 AAGAGGCACCACAAAGAGTTGGG - Intergenic
1102460073 12:113094673-113094695 AATGGGTACCAGAGAGAGTGTGG + Intronic
1103264422 12:119617048-119617070 AATTGGTACCACAGAGAGTGGGG + Intronic
1104210298 12:126682651-126682673 AATTGGTACCAAAAGAAATGTGG + Intergenic
1104542971 12:129684535-129684557 AACTGGCACCACAGAGAGTGGGG + Intronic
1105657593 13:22457550-22457572 AATTGGTGCTACAGAGAGTCGGG - Intergenic
1106718668 13:32417575-32417597 AATTGGTACCACAGAGAATGGGG + Intronic
1106863882 13:33941835-33941857 AATTGATAACACAAAGAATGAGG - Intronic
1107155279 13:37159107-37159129 CTTTGGTATCACAAGGAGTGAGG + Intergenic
1108525873 13:51285594-51285616 AAATGGAACCACAAAGGGTCAGG + Intergenic
1108829061 13:54453890-54453912 AATTGGTACCACAGAGAGTGGGG - Intergenic
1108968601 13:56343055-56343077 AATTAGTGTCACAGAGAGTGGGG - Intergenic
1109090443 13:58036799-58036821 AATAGGTAGCAGAAAGAGTAGGG + Intergenic
1109171805 13:59106735-59106757 AATTGGTATCACAAAGAATGGGG + Intergenic
1109252283 13:60033325-60033347 AATTGGTAAAAAAAAGAGTGGGG - Intronic
1109276289 13:60307412-60307434 AATTGGTACCACAGAGAGTGAGG - Intergenic
1109476278 13:62883413-62883435 AATTGGTACCACAGACACTGGGG - Intergenic
1109494309 13:63147787-63147809 AATTGATACCACAGAGAGTAGGG - Intergenic
1109948627 13:69471804-69471826 ACTTGGAAACACAAAGATTGTGG - Intergenic
1110022214 13:70489921-70489943 AATTGGTATCATGGAGAGTGGGG + Intergenic
1110980003 13:81885381-81885403 AATTGGTACTGCAGAGGGTGGGG - Intergenic
1111212530 13:85098167-85098189 AATTGGTACCGCAGAGAGTAGGG + Intergenic
1111222188 13:85219794-85219816 AATTGGTACTGCAGAGAGTGGGG + Intergenic
1111239562 13:85456872-85456894 AATTGGTACCACACAACGTGGGG + Intergenic
1111271377 13:85891785-85891807 AATTGGTACCACAGAGAGTGGGG + Intergenic
1111339180 13:86861776-86861798 AATTGGTACCAGGAGGAGTGGGG + Intergenic
1111501567 13:89128227-89128249 AATTGGTACTGCAGAAAGTGGGG - Intergenic
1112155693 13:96814743-96814765 AATAGGTAAGACAAATAGTGGGG - Intronic
1112568340 13:100570200-100570222 AATTTGTACCACAGAGAGTGGGG - Intronic
1112568422 13:100570806-100570828 AATTTGTACCACAGAGACTGGGG + Intronic
1112769585 13:102781117-102781139 AATTGGTACTGCAGAGAGTGAGG + Intergenic
1113087672 13:106584955-106584977 AATTGGTACTGCAGAGAGTGAGG + Intergenic
1114804592 14:25820314-25820336 CAATGGTACCACAAACAGTGGGG - Intergenic
1115197000 14:30812240-30812262 AATGGGCACTAGAAAGAGTGGGG - Intergenic
1115311402 14:31982131-31982153 AATTGGTACTGCAGAGAATGGGG + Intergenic
1115340372 14:32287367-32287389 AATTGGTACCATAGAGGGTGGGG + Intergenic
1115943129 14:38630267-38630289 AATTGTTACTGCAGAGAGTGGGG - Intergenic
1116533750 14:46005883-46005905 AATTGGTACCACAGAGAGTGGGG + Intergenic
1116637636 14:47417692-47417714 AATTGGTACCAGAAGGAGTGAGG - Intronic
1117161532 14:52994800-52994822 CCCTGGTACCAAAAAGAGTGGGG - Intergenic
1117203577 14:53417710-53417732 AATTGGTACTGTAGAGAGTGGGG + Intergenic
1117837832 14:59825904-59825926 AATGGGTACCACAAACTGTTAGG - Intronic
1118046608 14:61977288-61977310 AATTGGTACTGCCAAGAGTGGGG - Intergenic
1118484391 14:66200181-66200203 AATTGGTACCACAGAGACTGGGG + Intergenic
1118697802 14:68401871-68401893 AAATGGTAGCACAAATACTGCGG + Intronic
1119040287 14:71268588-71268610 AATTGGTAGCACAGTGAGTGGGG + Intergenic
1119306004 14:73608705-73608727 AGTTAGTATCACAGAGAGTGGGG - Intergenic
1120060588 14:79978029-79978051 AATTGGTACCATGGACAGTGGGG + Intergenic
1120234509 14:81875358-81875380 AATTGGTATTGCAGAGAGTGGGG + Intergenic
1120443194 14:84563459-84563481 AACTGGTAACACAAAGAGTGGGG + Intergenic
1120620226 14:86753820-86753842 AATTGGTACCACAGAGAGTAGGG - Intergenic
1120921180 14:89756687-89756709 AACTGGTAACACTGAGAGTGGGG - Intergenic
1121623713 14:95369540-95369562 ACTGGGTCCCACACAGAGTGGGG - Intergenic
1124556175 15:30727978-30728000 AATTGGTACCACAGAGAGTGGGG - Intronic
1124675096 15:31677792-31677814 AATTGGTATCACAGAGAGTGGGG + Intronic
1125246381 15:37646132-37646154 AATTGATACCACAGAGAGCAGGG + Intergenic
1126872304 15:53002611-53002633 AAGTGGTACCAGAAGGAGAGTGG - Intergenic
1127790977 15:62398426-62398448 AATTGGTACCGCAGAGAGTGGGG + Intronic
1128805533 15:70528237-70528259 AATTGGGATCACAAACAGGGTGG - Intergenic
1128921289 15:71612408-71612430 AAGTGGTTGCACAAAGAGGGAGG + Intronic
1129901172 15:79150551-79150573 AATTGGTACTGCAGAGAGTAGGG - Intergenic
1130409463 15:83632432-83632454 AATTGGTACTGCAGAGAGTGGGG - Intergenic
1131701027 15:94935478-94935500 AATTGGTAGAGCAGAGAGTGGGG - Intergenic
1132203855 15:99973235-99973257 AATGGGTACCACAAAGTCTGGGG + Exonic
1132350787 15:101138656-101138678 AATTGGAACTTCAAAAAGTGTGG - Intergenic
1133957278 16:10455533-10455555 ATTTGGTACCAGGAAGTGTGGGG + Intronic
1135477882 16:22793768-22793790 AAGTGGTAGCACGAAGAATGGGG - Intergenic
1135751971 16:25065473-25065495 GATTGGCATCACAAACAGTGTGG + Intergenic
1136864520 16:33734947-33734969 AATTGGTAAAACAAAGTCTGAGG + Intergenic
1137265965 16:46869306-46869328 AATTGGTACCACAGAGAGTGGGG - Intergenic
1137993602 16:53185077-53185099 AATTGGTACCAAAGAGAGTGGGG + Intronic
1138059440 16:53874624-53874646 AAGTGGTACAACAAAGTGAGAGG + Intronic
1139033358 16:62912276-62912298 AATTGGTACCACAGAGAGAGGGG - Intergenic
1143083967 17:4402045-4402067 AACTGGTGCCACAAAGCTTGGGG + Intergenic
1143935822 17:10482915-10482937 AATTGGTACCACAGAGAGTCGGG - Intergenic
1145357147 17:22169241-22169263 AATTGGTACTGCAGAGGGTGGGG - Intergenic
1147348655 17:39822924-39822946 TATTGGCACCACAGAGAGTGGGG + Intronic
1148447010 17:47744002-47744024 AATTGGTGCCCCAAAGAGTCCGG + Intronic
1149029360 17:52066152-52066174 AATTGGTATCACAGAGAATGGGG + Intronic
1149072092 17:52555573-52555595 AATTGGTACCACAGAGAGTGGGG + Intergenic
1149158859 17:53666846-53666868 AATTGGTACCACAGAGAGTGGGG + Intergenic
1149164017 17:53727884-53727906 AATTGGTACCACAGGGACTGGGG - Intergenic
1149339773 17:55673303-55673325 AATTGGTACCACAAAGAGTGGGG - Intergenic
1149628545 17:58098883-58098905 AATTAAAACCACAATGAGTGGGG - Intergenic
1151513378 17:74576594-74576616 AATTGGAAAGACAAAGATTGAGG + Intergenic
1154089865 18:11347672-11347694 CATTGGTAACACAAAATGTGGGG + Intergenic
1155680258 18:28478479-28478501 AACTGGTACCACCAGGAGTGGGG + Intergenic
1155716777 18:28953407-28953429 TATTGGTACCACAGAGATTGGGG - Intergenic
1155745721 18:29355000-29355022 AATTGGTAACATGGAGAGTGGGG + Intergenic
1155842994 18:30669029-30669051 AATTGCTACCACAGACAGTGTGG - Intergenic
1157522324 18:48353850-48353872 AAGTGGTAGCACCAAGACTGAGG + Intronic
1158071014 18:53470521-53470543 AATTGGTACCACAAAGAGTGTGG - Intronic
1158299350 18:56034180-56034202 AATTGGTACCATAGAGAGTGGGG - Intergenic
1159261406 18:66017107-66017129 AATTAGTACCAGAGAGAGTGGGG - Intergenic
1159357558 18:67357554-67357576 AATTGGTACCACAGAGAGTGGGG + Intergenic
1159640528 18:70858673-70858695 AATTGGTACCACAGAGAGTGGGG + Intergenic
1159652482 18:70994867-70994889 AATTGGTACTGCAGAGAGTGGGG + Intergenic
1159717853 18:71848431-71848453 TATTGGTACCACAGAGAGTGGGG + Intergenic
1159767787 18:72510645-72510667 AATTGGTACCTCAGAGAGTGGGG - Intergenic
1159895880 18:73995747-73995769 AATTTGTACCACAGAGAGTGGGG + Intergenic
1160235640 18:77084178-77084200 AAATGATCTCACAAAGAGTGTGG - Intronic
1160258363 18:77266516-77266538 AATTGGTACTGCAGAGAGTGGGG - Intronic
1160627349 18:80219978-80220000 AATTGGTACCACAGAGAGTGAGG - Intronic
1162268460 19:9595238-9595260 AAGAGGTACCACAAGGAGTGGGG - Intergenic
1166574987 19:43828962-43828984 AATTTGCACCAACAAGAGTGGGG + Intronic
924966162 2:78215-78237 AATTGGCACCACAAAGGGTGGGG - Intergenic
925354305 2:3227053-3227075 AATTGGTACTGCAGAGAGTGAGG + Intronic
925489534 2:4376388-4376410 AATTGGTATCACAGAGAGTGGGG - Intergenic
926280701 2:11443440-11443462 AATTGGTACCACAGAGAGTGGGG - Intergenic
926564726 2:14456475-14456497 AATCAGTACCACCAGGAGTGGGG + Intergenic
926612023 2:14956461-14956483 AATTGGTACTACAGAGCGTGGGG - Intergenic
926840828 2:17078784-17078806 AATTGGTATCACAGAGAGTGGGG + Intergenic
926919611 2:17927417-17927439 AATTGGCACCACAGAGAGTGGGG - Intronic
926949440 2:18225977-18225999 AACTGGTACCATGGAGAGTGGGG + Intronic
927400864 2:22708199-22708221 AATTGGTACCAGAGAGAGTGGGG - Intergenic
928836887 2:35558263-35558285 AATTGGTATCACAGAGAGTGGGG + Intergenic
929771123 2:44892985-44893007 AATTAGTACCACAGAGAGTGGGG - Intergenic
930058535 2:47270422-47270444 AATTGGTACCAAAAAAAAAGGGG + Intergenic
930230019 2:48834144-48834166 AATTGGTACCACAGGAAGTGGGG + Intergenic
930256575 2:49100294-49100316 AACTGGTACCAAAAAGAAGGTGG + Intronic
930438384 2:51376255-51376277 AATCAGTACCACAGAGAGTGGGG + Intergenic
930456829 2:51616168-51616190 AATTGGTGCCACAGAGAGTGGGG - Intergenic
930687425 2:54324651-54324673 AATTGGTACCAAGAGAAGTGGGG + Intergenic
930939903 2:57000219-57000241 AATTGGTACTGCAGAGAGTGGGG - Intergenic
930959982 2:57250193-57250215 AATTGGTAACACATTGAGTGAGG + Intergenic
931176824 2:59862502-59862524 AATTGGTATCACAGAGAGTGGGG - Intergenic
932023246 2:68109599-68109621 AATTGTTACCACATAGAAAGTGG - Intronic
932508871 2:72264964-72264986 CATTGGTACCACAGAGAGTGAGG + Intronic
933445630 2:82376900-82376922 AATTGGCACTGCAGAGAGTGGGG + Intergenic
934700726 2:96437919-96437941 AATTGGTAACACAGAGAGTAGGG + Intergenic
936721415 2:115256013-115256035 AATTGGTACCACAGAAAGTTGGG - Intronic
939037289 2:137148377-137148399 AACTGGTACTGCAGAGAGTGGGG + Intronic
939052808 2:137329004-137329026 AATTGGTACCACAAAGACTAGGG + Intronic
939653869 2:144798334-144798356 AATTGGTACCACAATCTGTATGG + Intergenic
939784755 2:146495269-146495291 AATTGGTACCACAGAGAGTGGGG - Intergenic
940288815 2:152058259-152058281 AATTGGTACCGCAAAGAGGGGGG + Intronic
940360126 2:152788018-152788040 AATTGCTACTACAGAGGGTGGGG - Intergenic
940446465 2:153783962-153783984 AACTGGTACTGCAGAGAGTGGGG + Intergenic
940598735 2:155829326-155829348 AATTGGTACTGCAGAGAGTGAGG - Intergenic
940728313 2:157361130-157361152 AATTGGTACCACAGAGAGTGGGG + Intergenic
941445102 2:165590893-165590915 AATTGGTACCACAGGGAGTGGGG + Intronic
942934457 2:181538083-181538105 AACTGGTCCCAAAAAGGGTGGGG + Intronic
943880778 2:193141294-193141316 AATTGGTACCACAGAAAGTGGGG - Intergenic
944458275 2:199917803-199917825 AATTGGTACTGCAGAGAGTGGGG - Intronic
945357731 2:208859015-208859037 AATTGGTACTGCAGAGACTGGGG + Intergenic
945456234 2:210055358-210055380 AATTGGTACTGCAAAGAGTGAGG + Intronic
945930899 2:215853905-215853927 AATTGGTACCACAGGGAGTGGGG + Intergenic
946296114 2:218784906-218784928 AACTGGTGCCAAAAAGACTGGGG - Intronic
946562327 2:220927114-220927136 AATTGGTACCACAGAGAGTGGGG - Intergenic
946575663 2:221072571-221072593 AATTGGTACCACAAAGAATTGGG - Intergenic
948182207 2:235990897-235990919 AATTGGGACCACCAGGGGTGGGG + Intronic
948837595 2:240633211-240633233 AATTGGTACCACAGAGAGTGGGG + Intergenic
948878797 2:240845038-240845060 AACTCTTACCACAGAGAGTGGGG + Intergenic
1169580782 20:7021548-7021570 AATTGGTACTACAGAGACTGGGG + Intergenic
1169612148 20:7393515-7393537 GATTGGTACCACAAAGATAGAGG - Intergenic
1169637154 20:7705194-7705216 AATTGGTATGTCCAAGAGTGCGG + Intergenic
1169937316 20:10897622-10897644 ATGTGGTACCACAGGGAGTGGGG - Intergenic
1171050205 20:21851038-21851060 CCCTGGTACCACAAAGGGTGGGG - Intergenic
1172812094 20:37655618-37655640 AATTTGTACCTCAGAGAGTGGGG - Intergenic
1175862567 20:62158048-62158070 AATTGCAACCACACAGGGTGGGG - Intronic
1177244815 21:18509752-18509774 AACTGGTACCACAGGGAATGGGG + Intergenic
1177311355 21:19398745-19398767 AAAAAGTACCACAAAGAGAGTGG + Intergenic
1177317262 21:19477975-19477997 AATTGGTACCACAGAGAGTGGGG - Intergenic
1177471397 21:21564675-21564697 AATTAGTATCACATAGAGTGGGG - Intergenic
1177528918 21:22336051-22336073 AACTGGTACCACAGACAGTGGGG + Intergenic
1177570381 21:22878421-22878443 AATTGGTACCACAGAGAGTGGGG - Intergenic
1177622112 21:23610218-23610240 AATTTGTACTAAAAAGAATGGGG + Intergenic
1177688043 21:24465674-24465696 AATTGGCACTGCAGAGAGTGGGG + Intergenic
1177920141 21:27142484-27142506 TATTGGTACCATAAAAAGAGAGG - Intergenic
1179161547 21:38903585-38903607 AGTGGGTACCGCACAGAGTGTGG - Intergenic
1180153068 21:45962215-45962237 AATTGGTACTGCAGAGAGGGGGG - Intergenic
1182354089 22:29714454-29714476 AAGTGCTTCCACAAAGAGAGAGG + Intergenic
1182999482 22:34843347-34843369 AATTGGTACCACAGAGAGTGGGG + Intergenic
1183004404 22:34889184-34889206 AATTAGTACCACAGAGAGTCGGG + Intergenic
1184338760 22:43873750-43873772 AATTGGTACCACAGAGAGTGGGG + Intergenic
949261517 3:2107233-2107255 AATTGGTACTGCAGAGAGTGGGG - Intronic
949292348 3:2481998-2482020 AATTGGTACTGCAGAGAGTGGGG + Intronic
949721932 3:6999516-6999538 AATTAGTACTGCAGAGAGTGGGG - Intronic
950806219 3:15605094-15605116 AATTGGTAATGCAGAGAGTGGGG - Intronic
951354047 3:21642336-21642358 ACTTGGACACACAAAGAGTGAGG - Intronic
953456438 3:43046057-43046079 AATTGGTACCACAAAGAGTGGGG + Intronic
953583455 3:44178061-44178083 AATTTATAGAACAAAGAGTGGGG - Intergenic
953748391 3:45592377-45592399 AACTGGTGCCAAAAAGATTGAGG - Intronic
955419636 3:58723691-58723713 ACTTGGTACCAGAAAGAGAATGG - Intronic
956354563 3:68377140-68377162 AAGTTGTACCACAGAGAGTTGGG + Intronic
957374204 3:79335699-79335721 AATTGGTACCGCAGAGAGTGGGG + Intronic
957676869 3:83378227-83378249 AATTGCTACTGCAGAGAGTGGGG - Intergenic
957757428 3:84509063-84509085 AAATGGTACTGCAGAGAGTGGGG + Intergenic
958128278 3:89385648-89385670 AATTGGTACCACAGAGAGTGGGG + Intronic
958582637 3:96045927-96045949 AATTGGTACCATAGAGAGTGGGG - Intergenic
958672291 3:97220373-97220395 AATTGGTACCAAAGAGAGTGGGG - Intronic
958955259 3:100459596-100459618 AATCGGTACTGCAGAGAGTGGGG - Intergenic
959119289 3:102213133-102213155 AATTGGTACTGCACAGAGTGAGG - Intronic
959507824 3:107175450-107175472 AATTAGTACCATGGAGAGTGGGG + Intergenic
961503934 3:127357704-127357726 AGGTGGTACCACAAAGAGTAGGG - Intergenic
961691660 3:128674532-128674554 AATTGGGCACACAAAGGGTGGGG - Intronic
962035049 3:131642911-131642933 AATTGGTACTACAGAGAGTGGGG + Intronic
962111588 3:132456095-132456117 AATGGGAAACACAAACAGTGGGG - Intronic
963386327 3:144599062-144599084 AATTGGTACTGTAGAGAGTGGGG - Intergenic
963516683 3:146317519-146317541 TACTGGTACCACAGAGAGTGGGG - Intergenic
963978044 3:151505091-151505113 AATTGGTACCACAGAGAGTGGGG - Intergenic
964274570 3:154995867-154995889 AATTGGTACCACAGAGAGTGGGG - Intergenic
964562355 3:158011396-158011418 AAATGGTACCACAAAGAGTGGGG - Intergenic
964792899 3:160469738-160469760 AACTGGTACTGCAGAGAGTGGGG + Intronic
964926311 3:161962834-161962856 AATTAGTACTGCAGAGAGTGGGG + Intergenic
965012219 3:163108243-163108265 AGTTGGTACTGCAGAGAGTGGGG - Intergenic
965052174 3:163664603-163664625 AATAAGTACCACAGAGAGGGGGG - Intergenic
965065502 3:163842063-163842085 AATTGGTACTGCAGAGAGTGTGG - Intergenic
965234355 3:166096451-166096473 AATTGATACCATGAAGAGTAGGG + Intergenic
965506329 3:169519510-169519532 AAGTAGTTCCACAAACAGTGTGG + Intronic
966021090 3:175211664-175211686 AATTGGCACCAGAAAGCATGAGG - Intronic
967529228 3:190530018-190530040 ACTTGGAACCATAAAGAGTAAGG + Intronic
967586197 3:191216962-191216984 AATTGTTACCAAAGAGAGTGGGG - Intronic
967586555 3:191221278-191221300 AACAGGTACCACAGAGAGTGGGG + Intronic
968409462 4:375844-375866 AATTTTTACAAGAAAGAGTGAGG + Intronic
969163304 4:5280548-5280570 AATTGGTACCAAAAAGGTGGGGG - Intronic
970301975 4:14691314-14691336 AATTGGTACCACAGAGAGTGGGG + Intergenic
970577830 4:17445087-17445109 AATTGGTACTGCAGAGAGTGGGG - Intergenic
971440276 4:26677974-26677996 AATTGGTACTGCAGAGAGTGGGG + Intronic
971939688 4:33199099-33199121 ATTTGGTACTGCAGAGAGTGGGG + Intergenic
971962438 4:33506829-33506851 AATTTGTGCCACAGAGAGTAGGG + Intergenic
972033525 4:34492835-34492857 ATTTGGTACCACAGAGAGTGGGG + Intergenic
972051773 4:34743835-34743857 AATTGGCACCATGGAGAGTGGGG - Intergenic
972879412 4:43405881-43405903 AATTGGTACCATAGAGAGTAGGG + Intergenic
972880800 4:43419239-43419261 AATTGGTACCACACGGGGTGGGG - Intergenic
972885770 4:43485158-43485180 AATTGGTACCGCAAAGAGTGGGG - Intergenic
974214618 4:58828885-58828907 AATTCATGCCACAGAGAGTGGGG - Intergenic
974344532 4:60662053-60662075 AACTGATACCACAGAGAGTAGGG + Intergenic
974702859 4:65473329-65473351 AATTGGTACTTCAGAGAGCGGGG - Intronic
974872392 4:67659683-67659705 AATTGGTACTGTAGAGAGTGGGG + Intronic
974887360 4:67836163-67836185 AAGTAGTACCAAAAGGAGTGAGG - Intronic
974925422 4:68292148-68292170 AATTGGTACCAGAAATAGGATGG - Intergenic
974972405 4:68846060-68846082 AATTGGTACCACTGAGAGTGGGG - Intergenic
975302160 4:72802720-72802742 AATTGGTACCATAGAGACTGGGG - Intergenic
976702884 4:87990226-87990248 AATGAGTACCACAAACAGGGTGG - Intergenic
977006174 4:91571348-91571370 AATTGCTACCACAGAGTGTGGGG - Intronic
977360731 4:96000812-96000834 ATTTGCTTCCACAGAGAGTGGGG - Intergenic
977943058 4:102878834-102878856 AATTGCTACAACAGAGAGTTGGG - Intronic
977953627 4:103001792-103001814 AATTGGTACTGTGAAGAGTGGGG - Intronic
978044554 4:104110502-104110524 AATTGCTACCACTCATAGTGAGG + Intergenic
978235047 4:106447605-106447627 AATTGATACCACAGAGAGTGGGG - Intergenic
978313902 4:107414925-107414947 AAGAGGTACCACAAGGAGGGGGG + Intergenic
978666113 4:111183751-111183773 AATTGGTACCACAGAGAGTGGGG - Intergenic
979102931 4:116645245-116645267 AATTGGTACTGCAGAGAGTGGGG + Intergenic
979906629 4:126301366-126301388 AATTGGTACCGCAGAGAGTGCGG - Intergenic
979966782 4:127085828-127085850 AATTGGTACCACAGCCAGTGGGG + Intergenic
980282856 4:130742775-130742797 AATTGGTACCACAGAGAGTGGGG + Intergenic
980408340 4:132382246-132382268 AATTGGTACCACAGAGAGTGGGG - Intergenic
980596427 4:134961557-134961579 AATTGGTATCACAGAGAGTAGGG + Intergenic
980654714 4:135766864-135766886 AATTGGTACCACAGAGAAAGGGG - Intergenic
980758097 4:137191554-137191576 AATTGGTACCGTGGAGAGTGGGG - Intergenic
981242282 4:142492282-142492304 GATTGGTACCACAGAGAGAGGGG + Intronic
981914257 4:150016375-150016397 AATTGGTACCACACAGAGTGGGG - Intergenic
981915268 4:150026324-150026346 AATTGATACCTCAGAGAGTGGGG + Intergenic
982543293 4:156702692-156702714 AAATTGCACCACAAAGAGAGGGG + Intergenic
982608997 4:157550461-157550483 AATTGGTACCACAGAGAGTGGGG + Intergenic
982779589 4:159477104-159477126 CATAGGTACTACAAAGAGAGGGG - Intergenic
982799905 4:159692570-159692592 AATTGGTGCTGCAGAGAGTGGGG + Intergenic
983006280 4:162489563-162489585 AATTGGTACTGCAGAGAGTGGGG + Intergenic
983020557 4:162670768-162670790 TATTGGTACCCCAGAGAGTGTGG - Intergenic
984512378 4:180694188-180694210 AGTTGGTACCACAAAGAGTGGGG - Intergenic
984593961 4:181646364-181646386 AATTGCTGCCCCACAGAGTGTGG + Intergenic
985474013 5:67824-67846 AGTTGGTACCACAGAGAGTGGGG + Intergenic
986490058 5:8280212-8280234 AGTGGGGACCACAGAGAGTGAGG + Intergenic
986507889 5:8471596-8471618 AATTGACACCTCAGAGAGTGGGG - Intergenic
986532994 5:8758734-8758756 AATTTGTACCACAGACAGTGAGG + Intergenic
986987254 5:13513776-13513798 AATTGGTACCACAGAGAGTTGGG + Intergenic
987016608 5:13826735-13826757 AATTGGTGCCACATAGAGTGGGG + Intronic
987216682 5:15744672-15744694 AATTGCTACAACAGAGAGTGGGG - Intronic
987514643 5:18889547-18889569 AATTGGTACTACAGAGAGTGGGG - Intergenic
987802812 5:22720488-22720510 AATTGGTGCTGCAGAGAGTGGGG + Intronic
988076740 5:26363656-26363678 ACTTGGTACCACAGAGAGTGGGG + Intergenic
988181087 5:27795207-27795229 AGTTTGGACCACAAAGAGTAAGG + Intergenic
988345634 5:30034878-30034900 AATTGCTACCACAGAGAGTGGGG + Intergenic
988681710 5:33489965-33489987 TATTGGGAACACAGAGAGTGGGG - Intergenic
988724827 5:33916159-33916181 AATTGGTACTGCAGAGAGTGGGG + Intergenic
988892425 5:35632155-35632177 AATTGGTACCGGACAGAGTGGGG - Intronic
989032915 5:37137499-37137521 AATTGGTGCTGCAGAGAGTGGGG - Intronic
989224458 5:39010410-39010432 AACTGCTACCACAGAGAGTGGGG + Intronic
989494914 5:42101198-42101220 AATTAGTACTGCACAGAGTGGGG + Intergenic
989615651 5:43334805-43334827 AAGAGGTACCACAAGGAGGGGGG - Intergenic
989677045 5:43984333-43984355 AATTGGTACCACAGACAATGGGG - Intergenic
991184962 5:63795755-63795777 AATTGGTACTGCAGAGAGTGGGG - Intergenic
991390395 5:66136934-66136956 AATTGGTGCCACTGAGAGGGTGG - Intergenic
991535799 5:67668329-67668351 AATTGGTACCTCAAAGAGTGGGG + Intergenic
991941281 5:71854579-71854601 AATTGGTACTACAAAGACTAGGG - Intergenic
992310828 5:75497801-75497823 AAGTGGTACCGTAGAGAGTGGGG + Intronic
992818020 5:80464150-80464172 AATTGACACCCCAGAGAGTGGGG - Intronic
993238208 5:85344034-85344056 AATTGGTACCACAAAGAGTGTGG + Intergenic
993413310 5:87597452-87597474 AATTGGTACCACAGAAAGTGGGG - Intergenic
993451171 5:88073574-88073596 AATTGGTACCAGGAGTAGTGGGG + Intergenic
993537893 5:89109601-89109623 TATTGCTACCTGAAAGAGTGAGG - Intergenic
993569655 5:89521697-89521719 AATTGGGACTGCAGAGAGTGGGG - Intergenic
993703780 5:91147726-91147748 AATGGGTACCTCAGAGAGTGGGG + Intronic
994018864 5:95001274-95001296 AATTGGTACCAGGAGGAGTGGGG + Intronic
994942650 5:106344921-106344943 ACTTGGTACCACAGAGAGTGGGG + Intergenic
995119806 5:108523513-108523535 AAGGGGAACCAAAAAGAGTGAGG - Intergenic
995244066 5:109917602-109917624 AATTGGTACCACAGAGAGTGTGG + Intergenic
995283083 5:110357173-110357195 AACTGGTACCACAGAGAGAGGGG + Intronic
995390868 5:111639228-111639250 AATTCATACCACAGTGAGTGGGG + Intergenic
995534902 5:113125406-113125428 ATTTTGTGCCACAAAGAGTGAGG + Intronic
995608019 5:113879274-113879296 AATTGGTACCACAAAGAGTGGGG + Intergenic
996179210 5:120398810-120398832 AATTGGTACCACAGAGAGTTGGG + Intergenic
996467906 5:123824994-123825016 AATTTGTACCACAGAGAGTGTGG + Intergenic
996499609 5:124202599-124202621 AATTGGTACCTCAGAGAGTGGGG + Intergenic
996911265 5:128659793-128659815 AATTGGTACCTCAGAGAGAGGGG + Intronic
997091666 5:130865357-130865379 AATTGGTACCACAGAGATTGGGG - Intergenic
997775505 5:136600928-136600950 AATTGGTACTGCAGAGAGTGTGG + Intergenic
998753757 5:145353109-145353131 AATTGGTACCACAGAGAGTGGGG - Intergenic
998757038 5:145392118-145392140 AATTGGTACCACAGAGAGTGGGG - Intergenic
998978563 5:147675211-147675233 ACTTAGTCCCACAAAGGGTGAGG + Intronic
1000395575 5:160771640-160771662 TATTCTTACCACAAAAAGTGGGG - Intronic
1000516088 5:162237680-162237702 CATTTGTACCACAGAGGGTGGGG - Intergenic
1000622139 5:163497799-163497821 AACTGTTACAACAAAGAGGGTGG + Intergenic
1001473506 5:172032733-172032755 AATTGGTACAACAGAGACTGAGG - Intergenic
1001836375 5:174836203-174836225 AATTGGTACCGCAAAGAGTAGGG + Intergenic
1001943721 5:175760392-175760414 AATTGGTACTACAGAGAGTGAGG + Intergenic
1003227545 6:4219816-4219838 AATTGGTACCACAGAGAGTAGGG - Intergenic
1003791622 6:9552954-9552976 AATTGGTGCTACAGAGAGTGGGG - Intergenic
1004018265 6:11752140-11752162 AAAAGGTACCAAGAAGAGTGAGG - Intronic
1004430120 6:15535661-15535683 AATTGGTACTGGAGAGAGTGGGG + Intronic
1006028810 6:31164466-31164488 AATTGGGAACACAAAGGGTGGGG - Exonic
1006693175 6:35908153-35908175 AATTGGTACCACAGAGAGTGGGG + Intronic
1007097544 6:39223087-39223109 AATTGGTATTACAAAGAATCAGG - Intronic
1007791614 6:44312262-44312284 AACTGGAAGCACATAGAGTGGGG + Exonic
1008409446 6:51156744-51156766 AATTGGTACTACAAAACTTGGGG + Intergenic
1008522661 6:52377305-52377327 TATTGGTACCAGAAGGATTGTGG + Intronic
1009051491 6:58282087-58282109 AATTAGTACTGCAGAGAGTGGGG + Intergenic
1009285073 6:61805503-61805525 AATTGGTACCACATAGAGTAGGG - Intronic
1009501653 6:64421025-64421047 TATTGGTACCACAGAGAGTGAGG - Intronic
1009550659 6:65088196-65088218 AATCGGTACCACAGAGAGTGGGG + Intronic
1009946028 6:70342438-70342460 AATTGGTAGCTCAGAGAGTGGGG - Intergenic
1010061141 6:71624617-71624639 AACTGGTATCACAGAGAGTGGGG + Intergenic
1010473739 6:76261829-76261851 AATTGGTACCACAGAGAGTGGGG + Intergenic
1010525459 6:76895210-76895232 AATTGGTACCACAAAGAGTGGGG - Intergenic
1010539234 6:77070459-77070481 AATTGGTACTACAGAGAGTGGGG - Intergenic
1010595185 6:77754603-77754625 AATTGGTACTGCATAGAGTGGGG - Intronic
1010845430 6:80701675-80701697 AATTTGTACCACAGAGAGTGGGG + Intergenic
1011385883 6:86797366-86797388 AATTTGTACTACAGAAAGTGGGG - Intergenic
1011738371 6:90334789-90334811 AATTGGTACCACAGACAGTGGGG - Intergenic
1011867859 6:91853689-91853711 AATTGGTACTGCAGAGAGTGTGG + Intergenic
1011895150 6:92216237-92216259 AATTGGTACTGCCGAGAGTGGGG + Intergenic
1012019963 6:93905977-93905999 AATTGGTACTGCAAAGAGTGAGG - Intergenic
1012732569 6:102900826-102900848 CATTCATACCACAGAGAGTGGGG - Intergenic
1012768160 6:103396169-103396191 AACTGGTACCACAGAGAGTGGGG + Intergenic
1013151279 6:107448713-107448735 AATTGGTACCGTAGAGAGTGGGG - Intronic
1013925161 6:115463557-115463579 AATTGACACCTCAGAGAGTGGGG + Intergenic
1014067783 6:117146771-117146793 AACTGGTACCACAGAGAGTTGGG - Intergenic
1015351446 6:132224734-132224756 GATTGGTACCACAGACAGTGGGG + Intergenic
1015487774 6:133791189-133791211 AATTGGTACCACAGAGAGTGGGG - Intergenic
1015995653 6:138993323-138993345 TATTGGTACTGCAAAGAGTGCGG + Intergenic
1016242833 6:141952282-141952304 AATTGGTACTGCAGAGAGTTGGG + Intergenic
1016611956 6:145999817-145999839 AATTGGTACCGCAGAGAGTGGGG - Intergenic
1016638048 6:146317522-146317544 AATTGGTACCAAAAAGTAGGGGG - Intronic
1016790343 6:148060965-148060987 AGTTGGTACTGCAGAGAGTGGGG - Intergenic
1018093756 6:160367049-160367071 AATTGGTACTCCAGAGAATGGGG - Intronic
1018502648 6:164427941-164427963 TATTTGAACCTCAAAGAGTGTGG - Intergenic
1018516219 6:164582466-164582488 AATTGGTATCACAGAGAGTGGGG - Intergenic
1018527366 6:164728072-164728094 AATTGGTACTACAGACAGTGGGG + Intergenic
1018834232 6:167471162-167471184 AAATGGGACCACACAGGGTGGGG - Intergenic
1019039257 6:169090002-169090024 AATTGGTAGTGCAGAGAGTGGGG + Intergenic
1019150529 6:170002627-170002649 AATTAGTAGTACAGAGAGTGGGG - Intergenic
1021573418 7:22086875-22086897 AATTGGTACCACAGAGAGTGGGG - Intergenic
1021762159 7:23912730-23912752 AATTGGTACCACAGAGAGTGGGG + Intergenic
1022951802 7:35346368-35346390 AGTTGTAACCACAAAGACTGTGG + Intergenic
1023208309 7:37775466-37775488 AATTGGTACTGCAGAGAGTGGGG + Intronic
1024093566 7:45967238-45967260 AATTGGGACCTCAAAGAGCTAGG + Intergenic
1024384649 7:48737942-48737964 AATTGGTACCACAGAGAGTGGGG + Intergenic
1025038442 7:55618444-55618466 AATTGACACCACAGAGAGTGTGG + Intergenic
1025861695 7:65336645-65336667 AATTGGTACTGCATAGAGTAGGG + Intergenic
1028289185 7:89044398-89044420 AATTGGTATCACAGAAAGTGGGG + Intronic
1028463244 7:91119927-91119949 AATTGGTCAGACAAAGAGTGGGG + Intronic
1029106398 7:98179799-98179821 ACTTGTAAGCACAAAGAGTGTGG + Intronic
1030722511 7:112885846-112885868 AATTGGTACCACAGAAAGTGGGG - Intronic
1030871543 7:114762379-114762401 AAATGGTACCACGAAAAGGGTGG + Intergenic
1031249216 7:119357850-119357872 AATTGGTGTGACAGAGAGTGGGG - Intergenic
1031330499 7:120457812-120457834 AATTGATACCACAGAGATTGGGG - Intronic
1031608125 7:123793803-123793825 AATTAGCACCACAGAGAGTGGGG + Intergenic
1031645482 7:124220784-124220806 AATTGGTACCACAGAGAGTGCGG + Intergenic
1031914219 7:127547114-127547136 AATTGGTATGTCAGAGAGTGGGG - Intergenic
1033098130 7:138448551-138448573 AAGAGGTACCACAAGGAGTAGGG - Intergenic
1033166289 7:139041289-139041311 TATTGGTACCCCGAATAGTGAGG + Intergenic
1033764241 7:144470897-144470919 AATTAGTACCAAAATGATTGGGG - Intronic
1034209409 7:149349784-149349806 AATTGATACCACAGAGAGTGGGG - Intergenic
1034874630 7:154714348-154714370 AATTGGTGCTACGGAGAGTGAGG - Intronic
1035956796 8:4089162-4089184 GATTGTCACCATAAAGAGTGGGG - Intronic
1037050548 8:14367437-14367459 AATTGGTACTACAGAGAGTGGGG - Intronic
1037660364 8:20920967-20920989 AACTGCTATCACAGAGAGTGGGG - Intergenic
1038476083 8:27869214-27869236 AATGGGAACCACAAAGATTTGGG + Intergenic
1038982680 8:32776746-32776768 AATTGGTACCGCAGAGAGTGGGG + Intergenic
1039309125 8:36296915-36296937 AATTGACACCACAGAGAGTGGGG + Intergenic
1039689756 8:39851170-39851192 AAGAAGTACCACAAAGTGTGGGG - Intergenic
1039714908 8:40097506-40097528 AAGTGATACCACAAAGTGAGGGG + Intergenic
1040085590 8:43337089-43337111 AATTGGTACCAGGGATAGTGGGG + Intergenic
1040460835 8:47646476-47646498 ACTTGCTATCACAAAGAATGGGG - Intronic
1040644894 8:49387123-49387145 AATTGGTACTTCAGAGAGTGGGG + Intergenic
1041430564 8:57776981-57777003 AATTGGTACCTCAGAGAGTGGGG + Intergenic
1041494306 8:58468988-58469010 AATTGGTACCACAGAGAGTGGGG + Intergenic
1041823728 8:62068071-62068093 AATTCGTACTGCAGAGAGTGGGG + Intergenic
1041851966 8:62402790-62402812 AATTGGTACCGCAAAAAGTGGGG + Intronic
1041977717 8:63818452-63818474 AATTGGTAGCACAGATAGTGGGG - Intergenic
1042045030 8:64641187-64641209 ACTTGATACCAGACAGAGTGTGG + Intronic
1042265925 8:66909320-66909342 AATTGGTACTGCAGAGAGTGCGG + Intronic
1042429922 8:68693924-68693946 AAGGGGTACCACAAAAAGGGTGG + Intronic
1042601218 8:70501637-70501659 AATTGGTAACACAGACAGTGGGG + Intergenic
1043266392 8:78271857-78271879 AATTGGTACCACAGAAAGTGGGG - Intergenic
1043492602 8:80764163-80764185 AATTGGTACCACAGAGAGTGGGG - Intronic
1043940552 8:86191082-86191104 AATTGGTACCTCAGAGAATGGGG - Intergenic
1044051724 8:87514404-87514426 AATTGGTACTGCAGAGAGTGTGG + Intronic
1044851339 8:96431884-96431906 AATTGGTACTGCGGAGAGTGAGG + Intergenic
1045675760 8:104606805-104606827 AATTGGTACTGCAGAGAGTGGGG + Intronic
1045922512 8:107547869-107547891 AATTGGTACCACGGAGAGTGGGG - Intergenic
1046170276 8:110497047-110497069 AATTGGTACCACAGAGAGTGGGG + Intergenic
1046400311 8:113696791-113696813 TATTGGTGCCAGTAAGAGTGAGG + Intergenic
1046831360 8:118750423-118750445 AGTTGGTACTGCAGAGAGTGGGG + Intergenic
1047115861 8:121841402-121841424 AATTGGTACCACAGAGAGTGGGG + Intergenic
1047697467 8:127417058-127417080 AATTGGGAACACTAAGGGTGGGG + Exonic
1048518379 8:135131568-135131590 AAATGAAACCACAAGGAGTGAGG - Intergenic
1048806428 8:138245682-138245704 AATTGGTAACACAGAGAGTGGGG + Intronic
1049060276 8:140271231-140271253 AATTGGTCCCAAAAGGAGGGTGG + Intronic
1050086440 9:1971399-1971421 AATTGATACCACAGAGAGTGAGG + Intergenic
1050348208 9:4714707-4714729 AATTGGTCCTCCAAAGAGTAAGG + Intronic
1050441413 9:5667905-5667927 AATTGGTACTGCAGAGAGTGGGG - Intronic
1050923983 9:11240603-11240625 CACTGGTACCAAAAAGAATGGGG + Intergenic
1052540825 9:29809934-29809956 AATTAGTACCACAGAGAGTGGGG + Intergenic
1052666167 9:31497684-31497706 AATTGGTACCATAGAGAGTGGGG - Intergenic
1053371216 9:37563324-37563346 AATTGGTACTACAGAGAGTGGGG + Intronic
1054868439 9:70026428-70026450 AATTGGTACTGCAGATAGTGGGG - Intergenic
1055885842 9:81062538-81062560 AATTGGTACCACAGAGAGTGAGG + Intergenic
1056148835 9:83764510-83764532 AATTGGTACCACAGAGAGTCAGG + Intronic
1057233192 9:93337691-93337713 AATAGGTACTGAAAAGAGTGGGG + Intronic
1057903930 9:98969892-98969914 AATTGGGAACAAAAAGAGTGGGG + Intronic
1058181608 9:101806936-101806958 AAGTGGTACCAGAAGTAGTGTGG + Intergenic
1058222907 9:102325067-102325089 AATTTGTCCCAAAGAGAGTGGGG + Intergenic
1058486848 9:105450303-105450325 AATAGGTACTGCAAAGTGTGAGG + Intronic
1058573246 9:106370986-106371008 CATTGGTACCATAGAGAGTGGGG - Intergenic
1059662666 9:116417413-116417435 AATTGGAATCTCAATGAGTGTGG + Intergenic
1059811670 9:117861980-117862002 AATGGGGACCACAGAGAGTGTGG + Intergenic
1186372981 X:8966122-8966144 AATTGGTACTGCAGAGAGTAGGG - Intergenic
1186387269 X:9122521-9122543 AGTTGGTACCAGGAACAGTGCGG - Intronic
1186668622 X:11745850-11745872 CCCTGGTACCACAAAGATTGGGG - Intergenic
1186679431 X:11855907-11855929 AATTGGTACTGCAGAGAGTGGGG - Intergenic
1186704729 X:12129139-12129161 AACTGGTACCACAGATAGTAGGG - Intergenic
1187584031 X:20639938-20639960 AATAGGTAACACAAAGGGAGAGG - Intergenic
1188056507 X:25547377-25547399 AAGATGTACCACAAGGAGTGAGG - Intergenic
1188069795 X:25704873-25704895 AATTGGTACCATGAAAAGTGGGG + Intergenic
1188115086 X:26232700-26232722 AACTGGTACCACAGAGAGTGGGG - Intergenic
1188158820 X:26775668-26775690 AATTGGTACCAGAGAGAGTGGGG + Intergenic
1188162245 X:26818596-26818618 AATTGGTACTACAGAGAATGGGG + Intergenic
1188457031 X:30379005-30379027 AATTGGTACTGCAGAGAGTGTGG + Intergenic
1188588051 X:31801061-31801083 AATTGGTACTGCAGAGAGTGGGG - Intronic
1188651624 X:32637522-32637544 CATTGGTACCGCAGAGAGTGGGG - Intronic
1188774061 X:34190552-34190574 AATTGGTACCACAGAGAGTGGGG - Intergenic
1188857198 X:35210650-35210672 AATTTGTATCCCAGAGAGTGGGG - Intergenic
1188863538 X:35286502-35286524 AACTGGTACTGCAGAGAGTGGGG - Intergenic
1188926414 X:36050157-36050179 AATTGGTACCACAGAGAGTGGGG + Intronic
1189877854 X:45455342-45455364 AATTGGTACCACAGAGAGTGAGG + Intergenic
1190387502 X:49897297-49897319 CATTGATACCACAGAGAGTGGGG + Intergenic
1190950511 X:55138915-55138937 AATTGGTACTGCGGAGAGTGGGG + Intronic
1191084161 X:56546542-56546564 AATTGATACCACATAGAGTGGGG - Intergenic
1191689666 X:63926813-63926835 AATTGGTACCAAAGAGAGAGGGG + Intergenic
1191697771 X:64007068-64007090 AATAGGTACAACAGAGAGTGGGG - Intergenic
1191742432 X:64450046-64450068 AATTGGTGCCACAGAGAGTGGGG - Intergenic
1192334855 X:70209973-70209995 AATTGGCACCACAGAGAGTGGGG + Intergenic
1193008026 X:76643123-76643145 AATTGGTATGGCAGAGAGTGGGG + Intergenic
1193025259 X:76839861-76839883 AATTGTTACCACAGACAGTGGGG - Intergenic
1193246647 X:79237788-79237810 ACTTGGTACCACATAGAGTGGGG - Intergenic
1193273243 X:79554015-79554037 AATTTGTACCTCAGAGTGTGGGG + Intergenic
1193316636 X:80072476-80072498 AACTGGTACCACAGAGAATAAGG - Intergenic
1193487044 X:82098493-82098515 AACAAGTACCACAATGAGTGGGG - Intergenic
1193506386 X:82349353-82349375 AATTGGTACCACAGAGAGTGGGG - Intergenic
1193682571 X:84540619-84540641 AATTGGTACCACAGAGAGTGGGG + Intergenic
1193888059 X:87007385-87007407 AATTGGTACCACAGAGAATGGGG - Intergenic
1193981261 X:88184729-88184751 AATTGATACCACAGAGAGTGGGG + Intergenic
1194365360 X:93007381-93007403 AATTGGTACTGCAGACAGTGGGG - Intergenic
1194495966 X:94616841-94616863 AATTGGTACCACAGAGAGTGTGG - Intergenic
1194756198 X:97742554-97742576 AATTGGTACCACAGAGAGTGGGG + Intergenic
1194778316 X:97992291-97992313 AATTGCTACCACAGAGAGCAGGG - Intergenic
1194952543 X:100144409-100144431 AATTGGTACTGCAGAGAGTGGGG + Intergenic
1195456162 X:105072366-105072388 AATTAGTACCACAAAGAATGGGG + Intronic
1195511676 X:105722948-105722970 AATAGGGAACACCAAGAGTGTGG - Intronic
1195838739 X:109149288-109149310 AATTGTTACCACAGAAAGTGGGG + Intergenic
1196012721 X:110905626-110905648 AATTGGTACTGCAGAGAGTGGGG - Intergenic
1196314990 X:114211776-114211798 AATTGGTACTACAGAGAGTGGGG - Intergenic
1196512939 X:116533372-116533394 AATTGGTACTGCAGAGAGTGGGG - Intergenic
1196543742 X:116938530-116938552 AATTGATACCACAGAGAATGGGG - Intergenic
1196605764 X:117655431-117655453 AATTGATACCTCAGAGAGTGGGG - Intergenic
1196930532 X:120676973-120676995 AATTGGTACCACAGAGAGTGGGG - Intergenic
1197004429 X:121479785-121479807 AATTGATACCACAGAGAGTGGGG + Intergenic
1197016667 X:121633411-121633433 AATTAGTACCGCTGAGAGTGTGG - Intergenic
1197109668 X:122757315-122757337 AATTGTTACCACAGAGAGTGAGG - Intergenic
1197368685 X:125599780-125599802 AATTGGTACCACAGAGAGTGGGG + Intergenic
1197451979 X:126630119-126630141 AATTGGTACCACAGAGAGTGGGG - Intergenic
1197566331 X:128092488-128092510 ACTTGGTGGTACAAAGAGTGAGG - Intergenic
1197583317 X:128311706-128311728 AATTGGTACTGCAGAGAGTGGGG - Intergenic
1198269303 X:135039471-135039493 AAATGGGACCACAAACATTGAGG - Intergenic
1198274554 X:135088699-135088721 AATTGGTACCAGGAGTAGTGAGG + Intergenic
1198740879 X:139841417-139841439 AATTGTTTCTACAAAGGGTGAGG + Intronic
1198952149 X:142083408-142083430 AATTGGTACTGCAGAGAGTGGGG - Intergenic
1198991651 X:142521357-142521379 AATTGGTACTGCAGAGAGTGTGG - Intergenic
1199051598 X:143242774-143242796 AATTGGTACCACAGACAGTGGGG - Intergenic
1199072858 X:143498804-143498826 AATCGGTACTGCAGAGAGTGAGG - Intergenic
1199637467 X:149826914-149826936 AAGAGGTACCACAAGGAGGGTGG + Intergenic
1199908864 X:152262836-152262858 AACTGGTATCACAGAGAGTCGGG - Intronic
1200673578 Y:6123639-6123661 AATTGGTACTGCAGACAGTGGGG - Intergenic