ID: 995608020

View in Genome Browser
Species Human (GRCh38)
Location 5:113879282-113879304
Sequence CAGCAGCGCCCCACTCTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995608020_995608022 -4 Left 995608020 5:113879282-113879304 CCACAAAGAGTGGGGCGCTGCTG No data
Right 995608022 5:113879301-113879323 GCTGTAGAGGCCCAGAAATGTGG No data
995608020_995608023 -1 Left 995608020 5:113879282-113879304 CCACAAAGAGTGGGGCGCTGCTG No data
Right 995608023 5:113879304-113879326 GTAGAGGCCCAGAAATGTGGAGG No data
995608020_995608028 22 Left 995608020 5:113879282-113879304 CCACAAAGAGTGGGGCGCTGCTG No data
Right 995608028 5:113879327-113879349 TGACTTTGGAACCAGGTAACAGG No data
995608020_995608027 15 Left 995608020 5:113879282-113879304 CCACAAAGAGTGGGGCGCTGCTG No data
Right 995608027 5:113879320-113879342 GTGGAGGTGACTTTGGAACCAGG No data
995608020_995608026 8 Left 995608020 5:113879282-113879304 CCACAAAGAGTGGGGCGCTGCTG No data
Right 995608026 5:113879313-113879335 CAGAAATGTGGAGGTGACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995608020 Original CRISPR CAGCAGCGCCCCACTCTTTG TGG (reversed) Intergenic
No off target data available for this crispr