ID: 995608021

View in Genome Browser
Species Human (GRCh38)
Location 5:113879288-113879310
Sequence AGAGTGGGGCGCTGCTGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995608012_995608021 27 Left 995608012 5:113879238-113879260 CCAATTAAATCTCTTTCCAATAT No data
Right 995608021 5:113879288-113879310 AGAGTGGGGCGCTGCTGTAGAGG No data
995608013_995608021 11 Left 995608013 5:113879254-113879276 CCAATATTAATTACCCAATAAAT No data
Right 995608021 5:113879288-113879310 AGAGTGGGGCGCTGCTGTAGAGG No data
995608016_995608021 -3 Left 995608016 5:113879268-113879290 CCAATAAATTGGTACCACAAAGA No data
Right 995608021 5:113879288-113879310 AGAGTGGGGCGCTGCTGTAGAGG No data
995608015_995608021 -2 Left 995608015 5:113879267-113879289 CCCAATAAATTGGTACCACAAAG No data
Right 995608021 5:113879288-113879310 AGAGTGGGGCGCTGCTGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995608021 Original CRISPR AGAGTGGGGCGCTGCTGTAG AGG Intergenic
No off target data available for this crispr