ID: 995608023

View in Genome Browser
Species Human (GRCh38)
Location 5:113879304-113879326
Sequence GTAGAGGCCCAGAAATGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995608013_995608023 27 Left 995608013 5:113879254-113879276 CCAATATTAATTACCCAATAAAT No data
Right 995608023 5:113879304-113879326 GTAGAGGCCCAGAAATGTGGAGG No data
995608015_995608023 14 Left 995608015 5:113879267-113879289 CCCAATAAATTGGTACCACAAAG No data
Right 995608023 5:113879304-113879326 GTAGAGGCCCAGAAATGTGGAGG No data
995608020_995608023 -1 Left 995608020 5:113879282-113879304 CCACAAAGAGTGGGGCGCTGCTG No data
Right 995608023 5:113879304-113879326 GTAGAGGCCCAGAAATGTGGAGG No data
995608016_995608023 13 Left 995608016 5:113879268-113879290 CCAATAAATTGGTACCACAAAGA No data
Right 995608023 5:113879304-113879326 GTAGAGGCCCAGAAATGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995608023 Original CRISPR GTAGAGGCCCAGAAATGTGG AGG Intergenic
No off target data available for this crispr