ID: 995608026

View in Genome Browser
Species Human (GRCh38)
Location 5:113879313-113879335
Sequence CAGAAATGTGGAGGTGACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995608015_995608026 23 Left 995608015 5:113879267-113879289 CCCAATAAATTGGTACCACAAAG No data
Right 995608026 5:113879313-113879335 CAGAAATGTGGAGGTGACTTTGG No data
995608016_995608026 22 Left 995608016 5:113879268-113879290 CCAATAAATTGGTACCACAAAGA No data
Right 995608026 5:113879313-113879335 CAGAAATGTGGAGGTGACTTTGG No data
995608020_995608026 8 Left 995608020 5:113879282-113879304 CCACAAAGAGTGGGGCGCTGCTG No data
Right 995608026 5:113879313-113879335 CAGAAATGTGGAGGTGACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995608026 Original CRISPR CAGAAATGTGGAGGTGACTT TGG Intergenic
No off target data available for this crispr