ID: 995608027

View in Genome Browser
Species Human (GRCh38)
Location 5:113879320-113879342
Sequence GTGGAGGTGACTTTGGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995608020_995608027 15 Left 995608020 5:113879282-113879304 CCACAAAGAGTGGGGCGCTGCTG No data
Right 995608027 5:113879320-113879342 GTGGAGGTGACTTTGGAACCAGG No data
995608016_995608027 29 Left 995608016 5:113879268-113879290 CCAATAAATTGGTACCACAAAGA No data
Right 995608027 5:113879320-113879342 GTGGAGGTGACTTTGGAACCAGG No data
995608015_995608027 30 Left 995608015 5:113879267-113879289 CCCAATAAATTGGTACCACAAAG No data
Right 995608027 5:113879320-113879342 GTGGAGGTGACTTTGGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995608027 Original CRISPR GTGGAGGTGACTTTGGAACC AGG Intergenic
No off target data available for this crispr