ID: 995609281

View in Genome Browser
Species Human (GRCh38)
Location 5:113891724-113891746
Sequence ACCTAGGAAGTCCCATGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995609281_995609291 29 Left 995609281 5:113891724-113891746 CCCTAACATGGGACTTCCTAGGT No data
Right 995609291 5:113891776-113891798 CACCCACAAAAAGTCAAGGGTGG No data
995609281_995609289 25 Left 995609281 5:113891724-113891746 CCCTAACATGGGACTTCCTAGGT No data
Right 995609289 5:113891772-113891794 CCTTCACCCACAAAAAGTCAAGG No data
995609281_995609290 26 Left 995609281 5:113891724-113891746 CCCTAACATGGGACTTCCTAGGT No data
Right 995609290 5:113891773-113891795 CTTCACCCACAAAAAGTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995609281 Original CRISPR ACCTAGGAAGTCCCATGTTA GGG (reversed) Intergenic
No off target data available for this crispr