ID: 995610983

View in Genome Browser
Species Human (GRCh38)
Location 5:113910046-113910068
Sequence CTGTGTCCCTGAGCCCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995610978_995610983 -7 Left 995610978 5:113910030-113910052 CCAATCTGTAGCCCTTCTGTGTC No data
Right 995610983 5:113910046-113910068 CTGTGTCCCTGAGCCCTGGGAGG No data
995610977_995610983 -6 Left 995610977 5:113910029-113910051 CCCAATCTGTAGCCCTTCTGTGT No data
Right 995610983 5:113910046-113910068 CTGTGTCCCTGAGCCCTGGGAGG No data
995610976_995610983 0 Left 995610976 5:113910023-113910045 CCAAGGCCCAATCTGTAGCCCTT No data
Right 995610983 5:113910046-113910068 CTGTGTCCCTGAGCCCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995610983 Original CRISPR CTGTGTCCCTGAGCCCTGGG AGG Intergenic
No off target data available for this crispr