ID: 995614598

View in Genome Browser
Species Human (GRCh38)
Location 5:113946820-113946842
Sequence ATTGAGAAGCCAAAGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995614598_995614602 27 Left 995614598 5:113946820-113946842 CCTTTCTCCTTTGGCTTCTCAAT No data
Right 995614602 5:113946870-113946892 TAAACCAACTTTGCATTGCTGGG No data
995614598_995614601 26 Left 995614598 5:113946820-113946842 CCTTTCTCCTTTGGCTTCTCAAT No data
Right 995614601 5:113946869-113946891 TTAAACCAACTTTGCATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995614598 Original CRISPR ATTGAGAAGCCAAAGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr