ID: 995614827

View in Genome Browser
Species Human (GRCh38)
Location 5:113950194-113950216
Sequence TGGGAGCAGCAGAATGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995614827_995614834 30 Left 995614827 5:113950194-113950216 CCTCCCTCATTCTGCTGCTCCCA No data
Right 995614834 5:113950247-113950269 TGTTTAAGCTCACCCAAAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995614827 Original CRISPR TGGGAGCAGCAGAATGAGGG AGG (reversed) Intergenic
No off target data available for this crispr