ID: 995619730

View in Genome Browser
Species Human (GRCh38)
Location 5:114011476-114011498
Sequence AATCTCTAGGAGGAAATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995619730_995619736 9 Left 995619730 5:114011476-114011498 CCTTCTATTTCCTCCTAGAGATT No data
Right 995619736 5:114011508-114011530 TCCTACTCTCAAGCTACTCAGGG No data
995619730_995619735 8 Left 995619730 5:114011476-114011498 CCTTCTATTTCCTCCTAGAGATT No data
Right 995619735 5:114011507-114011529 CTCCTACTCTCAAGCTACTCAGG No data
995619730_995619738 15 Left 995619730 5:114011476-114011498 CCTTCTATTTCCTCCTAGAGATT No data
Right 995619738 5:114011514-114011536 TCTCAAGCTACTCAGGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995619730 Original CRISPR AATCTCTAGGAGGAAATAGA AGG (reversed) Intergenic
No off target data available for this crispr