ID: 995619735

View in Genome Browser
Species Human (GRCh38)
Location 5:114011507-114011529
Sequence CTCCTACTCTCAAGCTACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995619730_995619735 8 Left 995619730 5:114011476-114011498 CCTTCTATTTCCTCCTAGAGATT No data
Right 995619735 5:114011507-114011529 CTCCTACTCTCAAGCTACTCAGG No data
995619727_995619735 26 Left 995619727 5:114011458-114011480 CCTCTGTTTTTGGTAGCCCCTTC No data
Right 995619735 5:114011507-114011529 CTCCTACTCTCAAGCTACTCAGG No data
995619732_995619735 -5 Left 995619732 5:114011489-114011511 CCTAGAGATTCCATCAGCCTCCT No data
Right 995619735 5:114011507-114011529 CTCCTACTCTCAAGCTACTCAGG No data
995619728_995619735 10 Left 995619728 5:114011474-114011496 CCCCTTCTATTTCCTCCTAGAGA No data
Right 995619735 5:114011507-114011529 CTCCTACTCTCAAGCTACTCAGG No data
995619731_995619735 -2 Left 995619731 5:114011486-114011508 CCTCCTAGAGATTCCATCAGCCT No data
Right 995619735 5:114011507-114011529 CTCCTACTCTCAAGCTACTCAGG No data
995619729_995619735 9 Left 995619729 5:114011475-114011497 CCCTTCTATTTCCTCCTAGAGAT No data
Right 995619735 5:114011507-114011529 CTCCTACTCTCAAGCTACTCAGG No data
995619726_995619735 27 Left 995619726 5:114011457-114011479 CCCTCTGTTTTTGGTAGCCCCTT No data
Right 995619735 5:114011507-114011529 CTCCTACTCTCAAGCTACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995619735 Original CRISPR CTCCTACTCTCAAGCTACTC AGG Intergenic
No off target data available for this crispr