ID: 995619738

View in Genome Browser
Species Human (GRCh38)
Location 5:114011514-114011536
Sequence TCTCAAGCTACTCAGGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995619732_995619738 2 Left 995619732 5:114011489-114011511 CCTAGAGATTCCATCAGCCTCCT No data
Right 995619738 5:114011514-114011536 TCTCAAGCTACTCAGGGCCTTGG No data
995619730_995619738 15 Left 995619730 5:114011476-114011498 CCTTCTATTTCCTCCTAGAGATT No data
Right 995619738 5:114011514-114011536 TCTCAAGCTACTCAGGGCCTTGG No data
995619733_995619738 -8 Left 995619733 5:114011499-114011521 CCATCAGCCTCCTACTCTCAAGC No data
Right 995619738 5:114011514-114011536 TCTCAAGCTACTCAGGGCCTTGG No data
995619731_995619738 5 Left 995619731 5:114011486-114011508 CCTCCTAGAGATTCCATCAGCCT No data
Right 995619738 5:114011514-114011536 TCTCAAGCTACTCAGGGCCTTGG No data
995619728_995619738 17 Left 995619728 5:114011474-114011496 CCCCTTCTATTTCCTCCTAGAGA No data
Right 995619738 5:114011514-114011536 TCTCAAGCTACTCAGGGCCTTGG No data
995619729_995619738 16 Left 995619729 5:114011475-114011497 CCCTTCTATTTCCTCCTAGAGAT No data
Right 995619738 5:114011514-114011536 TCTCAAGCTACTCAGGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995619738 Original CRISPR TCTCAAGCTACTCAGGGCCT TGG Intergenic
No off target data available for this crispr