ID: 995622025

View in Genome Browser
Species Human (GRCh38)
Location 5:114036679-114036701
Sequence CACATCGAACACTATAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995622025_995622028 6 Left 995622025 5:114036679-114036701 CCTTCATTATAGTGTTCGATGTG No data
Right 995622028 5:114036708-114036730 TCATACATCGCTCTATTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995622025 Original CRISPR CACATCGAACACTATAATGA AGG (reversed) Intergenic
No off target data available for this crispr