ID: 995622028

View in Genome Browser
Species Human (GRCh38)
Location 5:114036708-114036730
Sequence TCATACATCGCTCTATTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995622025_995622028 6 Left 995622025 5:114036679-114036701 CCTTCATTATAGTGTTCGATGTG No data
Right 995622028 5:114036708-114036730 TCATACATCGCTCTATTCTGAGG No data
995622022_995622028 9 Left 995622022 5:114036676-114036698 CCCCCTTCATTATAGTGTTCGAT No data
Right 995622028 5:114036708-114036730 TCATACATCGCTCTATTCTGAGG No data
995622024_995622028 7 Left 995622024 5:114036678-114036700 CCCTTCATTATAGTGTTCGATGT No data
Right 995622028 5:114036708-114036730 TCATACATCGCTCTATTCTGAGG No data
995622023_995622028 8 Left 995622023 5:114036677-114036699 CCCCTTCATTATAGTGTTCGATG No data
Right 995622028 5:114036708-114036730 TCATACATCGCTCTATTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995622028 Original CRISPR TCATACATCGCTCTATTCTG AGG Intergenic
No off target data available for this crispr