ID: 995623576

View in Genome Browser
Species Human (GRCh38)
Location 5:114054238-114054260
Sequence CAGGCGCTGGGAGTGCATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995623576_995623585 26 Left 995623576 5:114054238-114054260 CCTTGATGCACTCCCAGCGCCTG No data
Right 995623585 5:114054287-114054309 TACTCTCTCTTTACTAGAGCAGG No data
995623576_995623581 -6 Left 995623576 5:114054238-114054260 CCTTGATGCACTCCCAGCGCCTG No data
Right 995623581 5:114054255-114054277 CGCCTGGCTGGTCCCTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995623576 Original CRISPR CAGGCGCTGGGAGTGCATCA AGG (reversed) Intergenic
No off target data available for this crispr