ID: 995623579

View in Genome Browser
Species Human (GRCh38)
Location 5:114054250-114054272
Sequence TCAGGGACCAGCCAGGCGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995623579_995623587 30 Left 995623579 5:114054250-114054272 CCCAGCGCCTGGCTGGTCCCTGA No data
Right 995623587 5:114054303-114054325 GAGCAGGAAAGTGAATACAAGGG No data
995623579_995623586 29 Left 995623579 5:114054250-114054272 CCCAGCGCCTGGCTGGTCCCTGA No data
Right 995623586 5:114054302-114054324 AGAGCAGGAAAGTGAATACAAGG No data
995623579_995623585 14 Left 995623579 5:114054250-114054272 CCCAGCGCCTGGCTGGTCCCTGA No data
Right 995623585 5:114054287-114054309 TACTCTCTCTTTACTAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995623579 Original CRISPR TCAGGGACCAGCCAGGCGCT GGG (reversed) Intergenic
No off target data available for this crispr