ID: 995623580

View in Genome Browser
Species Human (GRCh38)
Location 5:114054251-114054273
Sequence TTCAGGGACCAGCCAGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995623580_995623586 28 Left 995623580 5:114054251-114054273 CCAGCGCCTGGCTGGTCCCTGAA No data
Right 995623586 5:114054302-114054324 AGAGCAGGAAAGTGAATACAAGG No data
995623580_995623587 29 Left 995623580 5:114054251-114054273 CCAGCGCCTGGCTGGTCCCTGAA No data
Right 995623587 5:114054303-114054325 GAGCAGGAAAGTGAATACAAGGG No data
995623580_995623585 13 Left 995623580 5:114054251-114054273 CCAGCGCCTGGCTGGTCCCTGAA No data
Right 995623585 5:114054287-114054309 TACTCTCTCTTTACTAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995623580 Original CRISPR TTCAGGGACCAGCCAGGCGC TGG (reversed) Intergenic
No off target data available for this crispr