ID: 995623583

View in Genome Browser
Species Human (GRCh38)
Location 5:114054267-114054289
Sequence GTACTGAACATGCCTTTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995623583_995623586 12 Left 995623583 5:114054267-114054289 CCCTGAAAAGGCATGTTCAGTAC No data
Right 995623586 5:114054302-114054324 AGAGCAGGAAAGTGAATACAAGG No data
995623583_995623587 13 Left 995623583 5:114054267-114054289 CCCTGAAAAGGCATGTTCAGTAC No data
Right 995623587 5:114054303-114054325 GAGCAGGAAAGTGAATACAAGGG No data
995623583_995623585 -3 Left 995623583 5:114054267-114054289 CCCTGAAAAGGCATGTTCAGTAC No data
Right 995623585 5:114054287-114054309 TACTCTCTCTTTACTAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995623583 Original CRISPR GTACTGAACATGCCTTTTCA GGG (reversed) Intergenic
No off target data available for this crispr