ID: 995623585

View in Genome Browser
Species Human (GRCh38)
Location 5:114054287-114054309
Sequence TACTCTCTCTTTACTAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995623576_995623585 26 Left 995623576 5:114054238-114054260 CCTTGATGCACTCCCAGCGCCTG No data
Right 995623585 5:114054287-114054309 TACTCTCTCTTTACTAGAGCAGG No data
995623582_995623585 7 Left 995623582 5:114054257-114054279 CCTGGCTGGTCCCTGAAAAGGCA No data
Right 995623585 5:114054287-114054309 TACTCTCTCTTTACTAGAGCAGG No data
995623580_995623585 13 Left 995623580 5:114054251-114054273 CCAGCGCCTGGCTGGTCCCTGAA No data
Right 995623585 5:114054287-114054309 TACTCTCTCTTTACTAGAGCAGG No data
995623583_995623585 -3 Left 995623583 5:114054267-114054289 CCCTGAAAAGGCATGTTCAGTAC No data
Right 995623585 5:114054287-114054309 TACTCTCTCTTTACTAGAGCAGG No data
995623584_995623585 -4 Left 995623584 5:114054268-114054290 CCTGAAAAGGCATGTTCAGTACT No data
Right 995623585 5:114054287-114054309 TACTCTCTCTTTACTAGAGCAGG No data
995623579_995623585 14 Left 995623579 5:114054250-114054272 CCCAGCGCCTGGCTGGTCCCTGA No data
Right 995623585 5:114054287-114054309 TACTCTCTCTTTACTAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995623585 Original CRISPR TACTCTCTCTTTACTAGAGC AGG Intergenic
No off target data available for this crispr