ID: 995629451

View in Genome Browser
Species Human (GRCh38)
Location 5:114117572-114117594
Sequence CTGCATGCAGATATGGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995629447_995629451 24 Left 995629447 5:114117525-114117547 CCTTTGAAATAACTGGAGAGCAG No data
Right 995629451 5:114117572-114117594 CTGCATGCAGATATGGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995629451 Original CRISPR CTGCATGCAGATATGGACCC AGG Intergenic
No off target data available for this crispr