ID: 995631452

View in Genome Browser
Species Human (GRCh38)
Location 5:114137586-114137608
Sequence TTTTATATGCAGAAATGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995631450_995631452 -10 Left 995631450 5:114137573-114137595 CCTAGATATGTTGTTTTATATGC No data
Right 995631452 5:114137586-114137608 TTTTATATGCAGAAATGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995631452 Original CRISPR TTTTATATGCAGAAATGGCA TGG Intergenic
No off target data available for this crispr