ID: 995633537 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:114160155-114160177 |
| Sequence | CATTCTAAGCAGTATGTAGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 995633537_995633542 | 19 | Left | 995633537 | 5:114160155-114160177 | CCCTCTACATACTGCTTAGAATG | No data | ||
| Right | 995633542 | 5:114160197-114160219 | TGTTGTGTCTTTGTTCTCATTGG | 0: 2553 1: 4771 2: 3165 3: 1505 4: 1050 |
||||
| 995633537_995633539 | -6 | Left | 995633537 | 5:114160155-114160177 | CCCTCTACATACTGCTTAGAATG | No data | ||
| Right | 995633539 | 5:114160172-114160194 | AGAATGTGTCCCAGAGATTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 995633537 | Original CRISPR | CATTCTAAGCAGTATGTAGA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||