ID: 995633537

View in Genome Browser
Species Human (GRCh38)
Location 5:114160155-114160177
Sequence CATTCTAAGCAGTATGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995633537_995633542 19 Left 995633537 5:114160155-114160177 CCCTCTACATACTGCTTAGAATG No data
Right 995633542 5:114160197-114160219 TGTTGTGTCTTTGTTCTCATTGG 0: 2553
1: 4771
2: 3165
3: 1505
4: 1050
995633537_995633539 -6 Left 995633537 5:114160155-114160177 CCCTCTACATACTGCTTAGAATG No data
Right 995633539 5:114160172-114160194 AGAATGTGTCCCAGAGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995633537 Original CRISPR CATTCTAAGCAGTATGTAGA GGG (reversed) Intergenic
No off target data available for this crispr