ID: 995633542

View in Genome Browser
Species Human (GRCh38)
Location 5:114160197-114160219
Sequence TGTTGTGTCTTTGTTCTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 13044
Summary {0: 2553, 1: 4771, 2: 3165, 3: 1505, 4: 1050}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995633537_995633542 19 Left 995633537 5:114160155-114160177 CCCTCTACATACTGCTTAGAATG No data
Right 995633542 5:114160197-114160219 TGTTGTGTCTTTGTTCTCATTGG 0: 2553
1: 4771
2: 3165
3: 1505
4: 1050
995633540_995633542 -7 Left 995633540 5:114160181-114160203 CCCAGAGATTCTGGTATGTTGTG 0: 5962
1: 3684
2: 2668
3: 2590
4: 2820
Right 995633542 5:114160197-114160219 TGTTGTGTCTTTGTTCTCATTGG 0: 2553
1: 4771
2: 3165
3: 1505
4: 1050
995633541_995633542 -8 Left 995633541 5:114160182-114160204 CCAGAGATTCTGGTATGTTGTGT 0: 5965
1: 3762
2: 2711
3: 2654
4: 2990
Right 995633542 5:114160197-114160219 TGTTGTGTCTTTGTTCTCATTGG 0: 2553
1: 4771
2: 3165
3: 1505
4: 1050
995633538_995633542 18 Left 995633538 5:114160156-114160178 CCTCTACATACTGCTTAGAATGT No data
Right 995633542 5:114160197-114160219 TGTTGTGTCTTTGTTCTCATTGG 0: 2553
1: 4771
2: 3165
3: 1505
4: 1050

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995633542 Original CRISPR TGTTGTGTCTTTGTTCTCAT TGG Intergenic
Too many off-targets to display for this crispr