ID: 995640109

View in Genome Browser
Species Human (GRCh38)
Location 5:114246285-114246307
Sequence GGGATGATTATGCATCTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995640108_995640109 -6 Left 995640108 5:114246268-114246290 CCTAATAACTATAATGTGGGATG No data
Right 995640109 5:114246285-114246307 GGGATGATTATGCATCTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995640109 Original CRISPR GGGATGATTATGCATCTTAT TGG Intergenic
No off target data available for this crispr