ID: 995644949 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:114301089-114301111 |
| Sequence | GACTCTCAAGAACAGTCTAT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 995644949_995644952 | 27 | Left | 995644949 | 5:114301089-114301111 | CCTATAGACTGTTCTTGAGAGTC | No data | ||
| Right | 995644952 | 5:114301139-114301161 | CAATAGCACTGTTTTCTTCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 995644949 | Original CRISPR | GACTCTCAAGAACAGTCTAT AGG (reversed) | Intergenic | ||