ID: 995644950

View in Genome Browser
Species Human (GRCh38)
Location 5:114301111-114301133
Sequence GTTATTTACATAGTAATGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995644950_995644952 5 Left 995644950 5:114301111-114301133 CCTTACATTACTATGTAAATAAC No data
Right 995644952 5:114301139-114301161 CAATAGCACTGTTTTCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995644950 Original CRISPR GTTATTTACATAGTAATGTA AGG (reversed) Intergenic
No off target data available for this crispr