ID: 995644952

View in Genome Browser
Species Human (GRCh38)
Location 5:114301139-114301161
Sequence CAATAGCACTGTTTTCTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995644950_995644952 5 Left 995644950 5:114301111-114301133 CCTTACATTACTATGTAAATAAC No data
Right 995644952 5:114301139-114301161 CAATAGCACTGTTTTCTTCCAGG No data
995644949_995644952 27 Left 995644949 5:114301089-114301111 CCTATAGACTGTTCTTGAGAGTC No data
Right 995644952 5:114301139-114301161 CAATAGCACTGTTTTCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995644952 Original CRISPR CAATAGCACTGTTTTCTTCC AGG Intergenic