ID: 995647845

View in Genome Browser
Species Human (GRCh38)
Location 5:114332890-114332912
Sequence TCCTTCCCAGGTTATATTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995647845_995647849 14 Left 995647845 5:114332890-114332912 CCCAAAATATAACCTGGGAAGGA No data
Right 995647849 5:114332927-114332949 AGATTCACCTAATTCCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995647845 Original CRISPR TCCTTCCCAGGTTATATTTT GGG (reversed) Intergenic
No off target data available for this crispr