ID: 995650250

View in Genome Browser
Species Human (GRCh38)
Location 5:114361662-114361684
Sequence GCCCGACGTGCTGCAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 102}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995650238_995650250 7 Left 995650238 5:114361632-114361654 CCGTCCCTGAGCCTGCCCCCGGC 0: 1
1: 0
2: 8
3: 161
4: 805
Right 995650250 5:114361662-114361684 GCCCGACGTGCTGCAGTGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 102
995650245_995650250 -9 Left 995650245 5:114361648-114361670 CCCCGGCCAAGGTGGCCCGACGT 0: 1
1: 0
2: 0
3: 0
4: 35
Right 995650250 5:114361662-114361684 GCCCGACGTGCTGCAGTGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 102
995650246_995650250 -10 Left 995650246 5:114361649-114361671 CCCGGCCAAGGTGGCCCGACGTG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 995650250 5:114361662-114361684 GCCCGACGTGCTGCAGTGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 102
995650244_995650250 -8 Left 995650244 5:114361647-114361669 CCCCCGGCCAAGGTGGCCCGACG 0: 1
1: 0
2: 0
3: 0
4: 39
Right 995650250 5:114361662-114361684 GCCCGACGTGCTGCAGTGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 102
995650240_995650250 2 Left 995650240 5:114361637-114361659 CCTGAGCCTGCCCCCGGCCAAGG 0: 1
1: 0
2: 2
3: 20
4: 320
Right 995650250 5:114361662-114361684 GCCCGACGTGCTGCAGTGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 102
995650236_995650250 12 Left 995650236 5:114361627-114361649 CCACACCGTCCCTGAGCCTGCCC 0: 1
1: 0
2: 3
3: 36
4: 446
Right 995650250 5:114361662-114361684 GCCCGACGTGCTGCAGTGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 102
995650239_995650250 3 Left 995650239 5:114361636-114361658 CCCTGAGCCTGCCCCCGGCCAAG 0: 1
1: 0
2: 1
3: 16
4: 209
Right 995650250 5:114361662-114361684 GCCCGACGTGCTGCAGTGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 102
995650243_995650250 -4 Left 995650243 5:114361643-114361665 CCTGCCCCCGGCCAAGGTGGCCC 0: 1
1: 0
2: 2
3: 31
4: 344
Right 995650250 5:114361662-114361684 GCCCGACGTGCTGCAGTGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995650250 Original CRISPR GCCCGACGTGCTGCAGTGGC TGG Intronic
901339010 1:8478424-8478446 CTCCAAAGTGCTGCAGTGGCTGG + Intronic
901446855 1:9313757-9313779 GCCCGCTGTGCTTCAGTGGCTGG + Intronic
902641830 1:17771766-17771788 TCCTGACATGCTGCAGTGGAGGG + Intronic
905298303 1:36968687-36968709 GCCCCACGTGGAGCTGTGGCAGG - Intronic
907450464 1:54542663-54542685 GCCCGGCGCGCCGCAGAGGCTGG + Intronic
1063475015 10:6320681-6320703 GCCCAAAGTGCTGCAATTGCAGG + Intergenic
1066002302 10:31115978-31116000 TCCCAAAGTGCTGCAGTTGCAGG - Intergenic
1066452408 10:35542633-35542655 GACAGCCGTGCTGCAATGGCTGG - Intronic
1076715326 10:132361121-132361143 GCCAGGTTTGCTGCAGTGGCTGG - Intronic
1076888124 10:133271814-133271836 GCCCGCCATGATGCAGCGGCCGG + Exonic
1077109119 11:854344-854366 GCCCGGCGTCCCGCACTGGCAGG - Intronic
1077142470 11:1030610-1030632 GCCCACCATGCTGCACTGGCGGG + Exonic
1080897560 11:36459125-36459147 GCCAGACCGGTTGCAGTGGCTGG + Intronic
1084417857 11:69043780-69043802 GCCCGAGGTCCTGCAGAGGCTGG + Intergenic
1085100722 11:73797619-73797641 GCCCGCCCTGCTGCAGCAGCCGG + Intronic
1085200006 11:74696221-74696243 GCAGGAGGTGCTGCAGTGGGGGG + Intergenic
1107312085 13:39090168-39090190 GCTAGACTTGCTGCAGTGGGAGG - Intergenic
1113643118 13:111972489-111972511 TCGCGACCTGCTGCAGAGGCCGG - Intergenic
1114723530 14:24909275-24909297 GCATGACGTGCTGCTGGGGCTGG - Intronic
1117912325 14:60647947-60647969 GACCGACGGGCTGCAGTGCCGGG + Intronic
1122291436 14:100682377-100682399 GCTCAACGTGCTGGAGGGGCTGG + Intergenic
1122787951 14:104172598-104172620 GGCCGACGTGCTCCAGTCGGTGG + Exonic
1122826625 14:104373899-104373921 GCTGGAGGTGCTGCAGTGGCGGG - Intergenic
1125884611 15:43219456-43219478 TCATGACATGCTGCAGTGGCTGG - Intronic
1131131592 15:89903927-89903949 GCCCGAGGCGCTGAAGGGGCTGG - Exonic
1131182992 15:90253236-90253258 GCCCGACGCACTGCAGAGACAGG - Exonic
1132066797 15:98737873-98737895 GCCCTTCGTGCTGCACTGACAGG + Intronic
1133018151 16:2954520-2954542 TCCCGTGGTGTTGCAGTGGCGGG - Intergenic
1136029879 16:27495178-27495200 GCCCCAGGTGCAGGAGTGGCAGG + Intronic
1139512819 16:67437022-67437044 GCCTCCTGTGCTGCAGTGGCTGG - Exonic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1141733111 16:85835371-85835393 GCCCCACGTCCACCAGTGGCAGG + Intergenic
1144714610 17:17425243-17425265 GCCCGCCCTGCTGCAGCAGCCGG + Intergenic
1145225142 17:21122458-21122480 TCCCGAAGTGCTGCAGTTACAGG + Intergenic
1147793066 17:43025259-43025281 GCCCGAGCGGCTGCAGTTGCAGG + Exonic
1149658398 17:58322301-58322323 GCCCCACCTGCTGCAGTCTCCGG + Exonic
1151542415 17:74771346-74771368 GCCAGAGGTGCTGCCCTGGCTGG - Exonic
1151571831 17:74930309-74930331 GACGGCCGTGCTGCAGAGGCAGG - Exonic
1151684521 17:75638971-75638993 GTCCGACCTTCTGCAGTGGGTGG + Exonic
1152392915 17:80013382-80013404 GCCGGAGGGGCTGCAGGGGCTGG - Exonic
1157093206 18:44660791-44660813 GTCAGATCTGCTGCAGTGGCTGG + Intergenic
1162998002 19:14348605-14348627 GCTCCCCGCGCTGCAGTGGCGGG - Intergenic
1163065065 19:14786481-14786503 GCTCCACGCGCTGCAGCGGCGGG + Intergenic
1163367060 19:16881154-16881176 GTCAGAAGTGCTGCAGGGGCTGG + Intergenic
1164958270 19:32405525-32405547 GGCCGCGGAGCTGCAGTGGCGGG - Intronic
1166893072 19:46006502-46006524 GCCCTCCGTGTGGCAGTGGCGGG + Intronic
1166942443 19:46375039-46375061 GCCCGGCATGCAGCAGGGGCAGG - Intronic
1168588026 19:57609924-57609946 GGCAGACCTGCTTCAGTGGCAGG - Intronic
925947279 2:8877551-8877573 GCCCCACCTGCTGCAGGGCCTGG + Intronic
927266775 2:21161311-21161333 GCCTGCCCTGCAGCAGTGGCTGG - Intergenic
929572351 2:43030599-43030621 GGGCCACGTGCTGGAGTGGCGGG + Intergenic
932330382 2:70895302-70895324 TCCAGAGGTGGTGCAGTGGCTGG + Intergenic
933738892 2:85517407-85517429 GCCCAAAGTGCAGCTGTGGCAGG + Intergenic
937694258 2:124790022-124790044 GCCGTAGCTGCTGCAGTGGCCGG - Exonic
938416157 2:131105322-131105344 GCCGGACGTGCGGCAGTTGCAGG + Exonic
946171530 2:217898701-217898723 GCCCTTGTTGCTGCAGTGGCGGG + Intronic
946848883 2:223885818-223885840 GAGGGACGTGCTGCTGTGGCTGG - Intronic
947065198 2:226216799-226216821 GCCCTAGGTGCTCCAGGGGCAGG - Intergenic
948873727 2:240816891-240816913 GGCCCACGTGCTGCAGTTGGGGG - Intronic
948897267 2:240933298-240933320 GCTCGAGGTGCAGCAGTGCCGGG + Intronic
1170682955 20:18543130-18543152 GCCCGATGTGCTCCGGTGGCTGG + Exonic
1171324937 20:24282885-24282907 GACCCACCAGCTGCAGTGGCAGG + Intergenic
1174065328 20:47860558-47860580 GCCCCACCTGCTGCTGTGTCAGG - Intergenic
1180124354 21:45778895-45778917 GACCCACCTGCTCCAGTGGCAGG - Intronic
1180621454 22:17165302-17165324 GCCCTCCGTGCTGCAGGGACAGG - Intergenic
1184115105 22:42417666-42417688 GCCTGCCCTGCTGCAGGGGCAGG + Intronic
951485086 3:23202469-23202491 GGCCTTCGTGCTGCAGTGTCTGG + Intergenic
954249622 3:49357975-49357997 GGCGGACGTGCAGTAGTGGCTGG - Intronic
959259810 3:104062915-104062937 GCCAGAGGGACTGCAGTGGCAGG + Intergenic
961324680 3:126103199-126103221 GCCCGAGGGCCTGCAGTGGAGGG - Intergenic
969136760 4:5035541-5035563 GCCCAAAGTGCTGCCCTGGCAGG + Intergenic
982225391 4:153160865-153160887 TCCCGAAGTGCTGCAGTTACAGG + Intronic
985749772 5:1667450-1667472 GCCCGCGGTCCTGCAGGGGCCGG - Intergenic
986169438 5:5303727-5303749 GCCCAAGAAGCTGCAGTGGCTGG + Exonic
987258205 5:16179296-16179318 GGCCGGCGGGCTGCAGGGGCAGG + Exonic
989165755 5:38432341-38432363 GCCTGAGGGGCTGCAGTGGTGGG + Intronic
989279069 5:39621124-39621146 GCCCGCCCTGCTGCAGCAGCTGG - Intergenic
990923361 5:60993136-60993158 GCCCGCCCTGCTGCAGCAGCTGG - Intronic
995650250 5:114361662-114361684 GCCCGACGTGCTGCAGTGGCTGG + Intronic
1002450225 5:179314537-179314559 GCCCGGGGGGCTGCAGAGGCAGG - Intronic
1002672187 5:180876668-180876690 TCCTGACCTGCTCCAGTGGCAGG - Intergenic
1004304625 6:14488529-14488551 GCCTGCCCTGCTGCAGTAGCTGG + Intergenic
1018850141 6:167581748-167581770 TCCAGACCTGCTGCAGTGCCAGG + Intergenic
1019459477 7:1149323-1149345 GCCAGAGGTGCTGCAGACGCAGG + Intergenic
1023880738 7:44319610-44319632 GCACGACCAGCTGCAGGGGCTGG - Intronic
1023982474 7:45078059-45078081 GGCCCCCGTGCTGCAGTCGCTGG + Intergenic
1026904914 7:74057375-74057397 CCCCGAGGTGCTGCAGGAGCAGG + Intronic
1028201089 7:87962730-87962752 GAACGAGCTGCTGCAGTGGCTGG - Intronic
1029124873 7:98288848-98288870 TCCCAAAGTGCTGCAGTTGCAGG + Intronic
1032012745 7:128357540-128357562 GCCCAGCGTGCAGCAGGGGCAGG - Intronic
1033582836 7:142752438-142752460 CCCAGACGAGCTGCAGTGCCTGG + Exonic
1033585859 7:142773926-142773948 CCCAGACGAGCTGCAGTGCCTGG + Intergenic
1033658799 7:143390138-143390160 GCCCCATTTCCTGCAGTGGCAGG - Intronic
1035126053 7:156608217-156608239 GCCCACCGGGCTGCAGGGGCTGG - Intergenic
1038013411 8:23493282-23493304 GCCCGACGGACGCCAGTGGCAGG + Intergenic
1040386642 8:46918848-46918870 GCCCCTGGTGCAGCAGTGGCTGG - Intergenic
1041664570 8:60430157-60430179 GCCTAATGTGCTGCAGTGGAGGG - Intergenic
1049021565 8:139960802-139960824 GCCCCACCAGCTGCAGTGGCAGG - Intronic
1049373706 8:142279391-142279413 CCCCGACGTGCAGCAGCAGCGGG - Intronic
1049452290 8:142668803-142668825 GCCTGACGTGCAGGTGTGGCAGG - Intronic
1049598135 8:143494055-143494077 TCCCCACGTGCTGCTGAGGCAGG - Intronic
1049838497 8:144755262-144755284 CACCGACGGGCTGCAGAGGCCGG - Intronic
1056456478 9:86765908-86765930 TCCCGAAGTGCTGCAGTTACGGG + Intergenic
1057263278 9:93598103-93598125 GCCTGAGGAGCTGCAGGGGCAGG - Intronic
1057267785 9:93630423-93630445 GCCCCCCGTGTAGCAGTGGCTGG - Intronic
1057801255 9:98192660-98192682 GCCCGCCGGGCTGCAGGGGGAGG - Intergenic
1059950887 9:119461449-119461471 GCCCGAGGGGAGGCAGTGGCAGG - Intergenic
1189724251 X:43952687-43952709 GCCCCACGTCCTTCAGTGCCTGG - Intronic
1196732891 X:118958884-118958906 GGCTGGAGTGCTGCAGTGGCAGG - Intergenic
1199184008 X:144893714-144893736 TCCCAACGTGCTGCAATTGCAGG + Intergenic